Incidental Mutation 'R8995:Ubr1'
ID 684642
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R8995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120860269-120970715 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120866553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1623 (R1623W)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect probably damaging
Transcript: ENSMUST00000028728
AA Change: R1623W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: R1623W

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 121,531,025 *214R probably null Het
Acd A G 8: 105,700,499 L93P probably damaging Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Aldh1b1 T A 4: 45,803,413 M317K possibly damaging Het
Arfgap2 C A 2: 91,273,584 Q342K probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Asxl1 C T 2: 153,393,966 R323C probably damaging Het
Bank1 G T 3: 136,066,503 D656E possibly damaging Het
Bdh2 A G 3: 135,295,228 M120V probably damaging Het
Bend7 A G 2: 4,744,292 I73M probably damaging Het
Casc4 A C 2: 121,925,718 E409D probably damaging Het
Cd207 C A 6: 83,675,909 D80Y probably damaging Het
Cdon A G 9: 35,486,797 T937A probably damaging Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Ddx50 A G 10: 62,634,083 I375T probably damaging Het
Dhrs1 T A 14: 55,739,939 T241S probably benign Het
Eef1b2 T C 1: 63,178,470 Y79H probably damaging Het
Elmod2 A G 8: 83,322,686 C84R probably benign Het
Exo1 A G 1: 175,908,561 H837R probably benign Het
Fam207a G A 10: 77,497,469 R121* probably null Het
Fat3 T C 9: 16,375,602 N875S probably damaging Het
Flvcr1 A T 1: 191,011,620 L413Q probably damaging Het
Fras1 G T 5: 96,712,556 V2154F possibly damaging Het
Gm10031 T A 1: 156,525,303 V358E probably benign Het
Gm31371 A T 8: 19,903,424 H11L Het
Hectd4 G A 5: 121,254,359 V229M possibly damaging Het
Ifitm6 A T 7: 141,016,704 V52E probably damaging Het
Igkv4-58 A G 6: 69,500,527 S29P probably damaging Het
Klc1 G A 12: 111,776,910 A224T probably damaging Het
Knl1 T C 2: 119,072,509 S1564P probably benign Het
Krt25 T C 11: 99,316,556 D399G probably benign Het
Lamc1 T C 1: 153,332,247 Q98R probably benign Het
Lpar1 T A 4: 58,486,954 M106L probably damaging Het
Mpc1 A G 17: 8,283,952 Y21C probably benign Het
Msr1 T A 8: 39,589,419 I372F possibly damaging Het
Ndc80 T C 17: 71,508,603 N396D probably benign Het
Nphp4 G A 4: 152,538,888 R673H probably damaging Het
Nsd3 T C 8: 25,641,153 F178S probably damaging Het
Olfr404-ps1 A T 11: 74,239,794 T77S probably benign Het
Olfr969 T C 9: 39,796,017 I214T possibly damaging Het
Pcdhgb7 T A 18: 37,752,177 F133L probably damaging Het
Pikfyve A G 1: 65,205,587 probably null Het
Pld5 A T 1: 175,964,014 D475E probably benign Het
Prop1 G A 11: 50,951,060 P173L possibly damaging Het
Rabepk G A 2: 34,799,830 probably benign Het
Reln A G 5: 21,979,579 I1646T probably benign Het
Rexo1 A T 10: 80,550,261 L321Q probably damaging Het
Rfx3 T A 19: 27,806,325 E382V probably benign Het
Rnf20 C T 4: 49,648,437 T415I possibly damaging Het
Rpl10-ps3 T A 9: 50,344,778 D55V probably benign Het
Sag A G 1: 87,805,330 T7A probably benign Het
Saysd1 G A 14: 20,082,937 R51C probably damaging Het
Shprh T A 10: 11,164,830 Y682* probably null Het
Slc6a13 T C 6: 121,325,053 I198T probably damaging Het
Smyd5 C A 6: 85,438,847 C101* probably null Het
Spata31d1d A G 13: 59,726,607 V1038A probably benign Het
Stat6 T C 10: 127,658,642 S692P probably benign Het
Tbc1d9 A T 8: 83,271,551 M1246L probably benign Het
Tmprss5 T A 9: 49,114,594 probably null Het
Trim12a A T 7: 104,304,325 M193K probably benign Het
Ube2t T A 1: 134,971,920 L102H probably damaging Het
Ush2a T G 1: 188,444,653 M1338R probably damaging Het
Usp36 A T 11: 118,284,999 L112Q probably damaging Het
Vmn1r53 A G 6: 90,223,775 M189T probably benign Het
Vmn1r54 T C 6: 90,269,686 V194A probably benign Het
Vmn2r33 A G 7: 7,551,193 V787A probably damaging Het
Vps26a A G 10: 62,464,679 I236T probably damaging Het
Vwde A T 6: 13,195,997 L343Q probably damaging Het
Xdh A G 17: 73,898,374 V1032A probably damaging Het
Zan A G 5: 137,395,620 F4523S unknown Het
Zfand5 T A 19: 21,277,023 V66E probably benign Het
Zfp658 T A 7: 43,573,374 C358S possibly damaging Het
Zfp977 T A 7: 42,582,648 R64W probably damaging Het
Zfp995 C T 17: 21,880,191 S354N probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
R8856:Ubr1 UTSW 2 120904042 missense probably damaging 1.00
R9153:Ubr1 UTSW 2 120925988 missense probably benign 0.00
R9155:Ubr1 UTSW 2 120924134 missense possibly damaging 0.84
R9156:Ubr1 UTSW 2 120873122 critical splice donor site probably null
R9194:Ubr1 UTSW 2 120947844 missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120896519 missense probably benign 0.04
R9401:Ubr1 UTSW 2 120935284 missense probably benign 0.06
R9430:Ubr1 UTSW 2 120904025 missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120873146 missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120934339 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTTCCAGATGACTCCATACTCAC -3'
(R):5'- TAGCATAGGCCTCCTTTAAGTGG -3'

Sequencing Primer
(F):5'- TCACTTTAAGAAAATGCAGACTCCAG -3'
(R):5'- CAAATTTCTGTGGAGGCCAGC -3'
Posted On 2021-10-11