Incidental Mutation 'R8995:Rnf20'
ID 684648
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 49648437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 415 (T415I)
Ref Sequence ENSEMBL: ENSMUSP00000029989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000029989
AA Change: T415I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: T415I

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146547
SMART Domains Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156314
AA Change: T415I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: T415I

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
SCOP:d1gw5a_ 174 294 3e-3 SMART
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 606 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167496
AA Change: T415I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: T415I

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 121,531,025 *214R probably null Het
Acd A G 8: 105,700,499 L93P probably damaging Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Aldh1b1 T A 4: 45,803,413 M317K possibly damaging Het
Arfgap2 C A 2: 91,273,584 Q342K probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Asxl1 C T 2: 153,393,966 R323C probably damaging Het
Bank1 G T 3: 136,066,503 D656E possibly damaging Het
Bdh2 A G 3: 135,295,228 M120V probably damaging Het
Bend7 A G 2: 4,744,292 I73M probably damaging Het
Casc4 A C 2: 121,925,718 E409D probably damaging Het
Cd207 C A 6: 83,675,909 D80Y probably damaging Het
Cdon A G 9: 35,486,797 T937A probably damaging Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Ddx50 A G 10: 62,634,083 I375T probably damaging Het
Dhrs1 T A 14: 55,739,939 T241S probably benign Het
Eef1b2 T C 1: 63,178,470 Y79H probably damaging Het
Elmod2 A G 8: 83,322,686 C84R probably benign Het
Exo1 A G 1: 175,908,561 H837R probably benign Het
Fam207a G A 10: 77,497,469 R121* probably null Het
Fat3 T C 9: 16,375,602 N875S probably damaging Het
Flvcr1 A T 1: 191,011,620 L413Q probably damaging Het
Fras1 G T 5: 96,712,556 V2154F possibly damaging Het
Gm10031 T A 1: 156,525,303 V358E probably benign Het
Gm31371 A T 8: 19,903,424 H11L Het
Hectd4 G A 5: 121,254,359 V229M possibly damaging Het
Ifitm6 A T 7: 141,016,704 V52E probably damaging Het
Igkv4-58 A G 6: 69,500,527 S29P probably damaging Het
Klc1 G A 12: 111,776,910 A224T probably damaging Het
Knl1 T C 2: 119,072,509 S1564P probably benign Het
Krt25 T C 11: 99,316,556 D399G probably benign Het
Lamc1 T C 1: 153,332,247 Q98R probably benign Het
Lpar1 T A 4: 58,486,954 M106L probably damaging Het
Mpc1 A G 17: 8,283,952 Y21C probably benign Het
Msr1 T A 8: 39,589,419 I372F possibly damaging Het
Ndc80 T C 17: 71,508,603 N396D probably benign Het
Nphp4 G A 4: 152,538,888 R673H probably damaging Het
Nsd3 T C 8: 25,641,153 F178S probably damaging Het
Olfr404-ps1 A T 11: 74,239,794 T77S probably benign Het
Olfr969 T C 9: 39,796,017 I214T possibly damaging Het
Pcdhgb7 T A 18: 37,752,177 F133L probably damaging Het
Pikfyve A G 1: 65,205,587 probably null Het
Pld5 A T 1: 175,964,014 D475E probably benign Het
Prop1 G A 11: 50,951,060 P173L possibly damaging Het
Rabepk G A 2: 34,799,830 probably benign Het
Reln A G 5: 21,979,579 I1646T probably benign Het
Rexo1 A T 10: 80,550,261 L321Q probably damaging Het
Rfx3 T A 19: 27,806,325 E382V probably benign Het
Rpl10-ps3 T A 9: 50,344,778 D55V probably benign Het
Sag A G 1: 87,805,330 T7A probably benign Het
Saysd1 G A 14: 20,082,937 R51C probably damaging Het
Shprh T A 10: 11,164,830 Y682* probably null Het
Slc6a13 T C 6: 121,325,053 I198T probably damaging Het
Smyd5 C A 6: 85,438,847 C101* probably null Het
Spata31d1d A G 13: 59,726,607 V1038A probably benign Het
Stat6 T C 10: 127,658,642 S692P probably benign Het
Tbc1d9 A T 8: 83,271,551 M1246L probably benign Het
Tmprss5 T A 9: 49,114,594 probably null Het
Trim12a A T 7: 104,304,325 M193K probably benign Het
Ube2t T A 1: 134,971,920 L102H probably damaging Het
Ubr1 G A 2: 120,866,553 R1623W probably damaging Het
Ush2a T G 1: 188,444,653 M1338R probably damaging Het
Usp36 A T 11: 118,284,999 L112Q probably damaging Het
Vmn1r53 A G 6: 90,223,775 M189T probably benign Het
Vmn1r54 T C 6: 90,269,686 V194A probably benign Het
Vmn2r33 A G 7: 7,551,193 V787A probably damaging Het
Vps26a A G 10: 62,464,679 I236T probably damaging Het
Vwde A T 6: 13,195,997 L343Q probably damaging Het
Xdh A G 17: 73,898,374 V1032A probably damaging Het
Zan A G 5: 137,395,620 F4523S unknown Het
Zfand5 T A 19: 21,277,023 V66E probably benign Het
Zfp658 T A 7: 43,573,374 C358S possibly damaging Het
Zfp977 T A 7: 42,582,648 R64W probably damaging Het
Zfp995 C T 17: 21,880,191 S354N probably benign Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4726:Rnf20 UTSW 4 49654579 nonsense probably null
R4770:Rnf20 UTSW 4 49633412 critical splice donor site probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5379:Rnf20 UTSW 4 49652639 missense possibly damaging 0.47
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R6608:Rnf20 UTSW 4 49650051 missense probably benign 0.05
R7064:Rnf20 UTSW 4 49644580 nonsense probably null
R7776:Rnf20 UTSW 4 49644592 nonsense probably null
R8735:Rnf20 UTSW 4 49655964 missense possibly damaging 0.95
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCGTTGGGCCTTCCTAAG -3'
(R):5'- CCACTGGATGAATGGGATATTAGC -3'

Sequencing Primer
(F):5'- CCTTCCTAAGGTGGAATTGCG -3'
(R):5'- TCCATTAGTCAGGCAATCATATAGAG -3'
Posted On 2021-10-11