Mutagenetix > Incidental Mutations

Incidental Mutation 'R8995:Rnf20'

684648

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8995 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 49648437 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 415 (T415I)

Ref Sequence

ENSEMBL: ENSMUSP00000029989 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029989
AA Change: T415I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: T415I

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156314
AA Change: T415I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: T415I

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167496
AA Change: T415I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: T415I

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	A	G	8: 121,531,025	*214R	probably null	Het
Acd	A	G	8: 105,700,499	L93P	probably damaging	Het
Adgrv1	GTT	GT	13: 81,405,338		probably null	Het
Aldh1b1	T	A	4: 45,803,413	M317K	possibly damaging	Het
Arfgap2	C	A	2: 91,273,584	Q342K	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Asxl1	C	T	2: 153,393,966	R323C	probably damaging	Het
Bank1	G	T	3: 136,066,503	D656E	possibly damaging	Het
Bdh2	A	G	3: 135,295,228	M120V	probably damaging	Het
Bend7	A	G	2: 4,744,292	I73M	probably damaging	Het
Casc4	A	C	2: 121,925,718	E409D	probably damaging	Het
Cd207	C	A	6: 83,675,909	D80Y	probably damaging	Het
Cdon	A	G	9: 35,486,797	T937A	probably damaging	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Ddx50	A	G	10: 62,634,083	I375T	probably damaging	Het
Dhrs1	T	A	14: 55,739,939	T241S	probably benign	Het
Eef1b2	T	C	1: 63,178,470	Y79H	probably damaging	Het
Elmod2	A	G	8: 83,322,686	C84R	probably benign	Het
Exo1	A	G	1: 175,908,561	H837R	probably benign	Het
Fam207a	G	A	10: 77,497,469	R121*	probably null	Het
Fat3	T	C	9: 16,375,602	N875S	probably damaging	Het
Flvcr1	A	T	1: 191,011,620	L413Q	probably damaging	Het
Fras1	G	T	5: 96,712,556	V2154F	possibly damaging	Het
Gm10031	T	A	1: 156,525,303	V358E	probably benign	Het
Gm31371	A	T	8: 19,903,424	H11L		Het
Hectd4	G	A	5: 121,254,359	V229M	possibly damaging	Het
Ifitm6	A	T	7: 141,016,704	V52E	probably damaging	Het
Igkv4-58	A	G	6: 69,500,527	S29P	probably damaging	Het
Klc1	G	A	12: 111,776,910	A224T	probably damaging	Het
Knl1	T	C	2: 119,072,509	S1564P	probably benign	Het
Krt25	T	C	11: 99,316,556	D399G	probably benign	Het
Lamc1	T	C	1: 153,332,247	Q98R	probably benign	Het
Lpar1	T	A	4: 58,486,954	M106L	probably damaging	Het
Mpc1	A	G	17: 8,283,952	Y21C	probably benign	Het
Msr1	T	A	8: 39,589,419	I372F	possibly damaging	Het
Ndc80	T	C	17: 71,508,603	N396D	probably benign	Het
Nphp4	G	A	4: 152,538,888	R673H	probably damaging	Het
Nsd3	T	C	8: 25,641,153	F178S	probably damaging	Het
Olfr404-ps1	A	T	11: 74,239,794	T77S	probably benign	Het
Olfr969	T	C	9: 39,796,017	I214T	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,177	F133L	probably damaging	Het
Pikfyve	A	G	1: 65,205,587		probably null	Het
Pld5	A	T	1: 175,964,014	D475E	probably benign	Het
Prop1	G	A	11: 50,951,060	P173L	possibly damaging	Het
Rabepk	G	A	2: 34,799,830		probably benign	Het
Reln	A	G	5: 21,979,579	I1646T	probably benign	Het
Rexo1	A	T	10: 80,550,261	L321Q	probably damaging	Het
Rfx3	T	A	19: 27,806,325	E382V	probably benign	Het
Rpl10-ps3	T	A	9: 50,344,778	D55V	probably benign	Het
Sag	A	G	1: 87,805,330	T7A	probably benign	Het
Saysd1	G	A	14: 20,082,937	R51C	probably damaging	Het
Shprh	T	A	10: 11,164,830	Y682*	probably null	Het
Slc6a13	T	C	6: 121,325,053	I198T	probably damaging	Het
Smyd5	C	A	6: 85,438,847	C101*	probably null	Het
Spata31d1d	A	G	13: 59,726,607	V1038A	probably benign	Het
Stat6	T	C	10: 127,658,642	S692P	probably benign	Het
Tbc1d9	A	T	8: 83,271,551	M1246L	probably benign	Het
Tmprss5	T	A	9: 49,114,594		probably null	Het
Trim12a	A	T	7: 104,304,325	M193K	probably benign	Het
Ube2t	T	A	1: 134,971,920	L102H	probably damaging	Het
Ubr1	G	A	2: 120,866,553	R1623W	probably damaging	Het
Ush2a	T	G	1: 188,444,653	M1338R	probably damaging	Het
Usp36	A	T	11: 118,284,999	L112Q	probably damaging	Het
Vmn1r53	A	G	6: 90,223,775	M189T	probably benign	Het
Vmn1r54	T	C	6: 90,269,686	V194A	probably benign	Het
Vmn2r33	A	G	7: 7,551,193	V787A	probably damaging	Het
Vps26a	A	G	10: 62,464,679	I236T	probably damaging	Het
Vwde	A	T	6: 13,195,997	L343Q	probably damaging	Het
Xdh	A	G	17: 73,898,374	V1032A	probably damaging	Het
Zan	A	G	5: 137,395,620	F4523S	unknown	Het
Zfand5	T	A	19: 21,277,023	V66E	probably benign	Het
Zfp658	T	A	7: 43,573,374	C358S	possibly damaging	Het
Zfp977	T	A	7: 42,582,648	R64W	probably damaging	Het
Zfp995	C	T	17: 21,880,191	S354N	probably benign	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTTCGTTGGGCCTTCCTAAG -3'
(R):5'- CCACTGGATGAATGGGATATTAGC -3'

Sequencing Primer
(F):5'- CCTTCCTAAGGTGGAATTGCG -3'
(R):5'- TCCATTAGTCAGGCAATCATATAGAG -3'

Posted On

2021-10-11