Incidental Mutation 'R8995:Hectd4'
ID 684654
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R8995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 121220219-121368577 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121254359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 229 (V229M)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: V229M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: V229M

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 121,531,025 *214R probably null Het
Acd A G 8: 105,700,499 L93P probably damaging Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Aldh1b1 T A 4: 45,803,413 M317K possibly damaging Het
Arfgap2 C A 2: 91,273,584 Q342K probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Asxl1 C T 2: 153,393,966 R323C probably damaging Het
Bank1 G T 3: 136,066,503 D656E possibly damaging Het
Bdh2 A G 3: 135,295,228 M120V probably damaging Het
Bend7 A G 2: 4,744,292 I73M probably damaging Het
Casc4 A C 2: 121,925,718 E409D probably damaging Het
Cd207 C A 6: 83,675,909 D80Y probably damaging Het
Cdon A G 9: 35,486,797 T937A probably damaging Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Ddx50 A G 10: 62,634,083 I375T probably damaging Het
Dhrs1 T A 14: 55,739,939 T241S probably benign Het
Eef1b2 T C 1: 63,178,470 Y79H probably damaging Het
Elmod2 A G 8: 83,322,686 C84R probably benign Het
Exo1 A G 1: 175,908,561 H837R probably benign Het
Fam207a G A 10: 77,497,469 R121* probably null Het
Fat3 T C 9: 16,375,602 N875S probably damaging Het
Flvcr1 A T 1: 191,011,620 L413Q probably damaging Het
Fras1 G T 5: 96,712,556 V2154F possibly damaging Het
Gm10031 T A 1: 156,525,303 V358E probably benign Het
Gm31371 A T 8: 19,903,424 H11L Het
Ifitm6 A T 7: 141,016,704 V52E probably damaging Het
Igkv4-58 A G 6: 69,500,527 S29P probably damaging Het
Klc1 G A 12: 111,776,910 A224T probably damaging Het
Knl1 T C 2: 119,072,509 S1564P probably benign Het
Krt25 T C 11: 99,316,556 D399G probably benign Het
Lamc1 T C 1: 153,332,247 Q98R probably benign Het
Lpar1 T A 4: 58,486,954 M106L probably damaging Het
Mpc1 A G 17: 8,283,952 Y21C probably benign Het
Msr1 T A 8: 39,589,419 I372F possibly damaging Het
Ndc80 T C 17: 71,508,603 N396D probably benign Het
Nphp4 G A 4: 152,538,888 R673H probably damaging Het
Nsd3 T C 8: 25,641,153 F178S probably damaging Het
Olfr404-ps1 A T 11: 74,239,794 T77S probably benign Het
Olfr969 T C 9: 39,796,017 I214T possibly damaging Het
Pcdhgb7 T A 18: 37,752,177 F133L probably damaging Het
Pikfyve A G 1: 65,205,587 probably null Het
Pld5 A T 1: 175,964,014 D475E probably benign Het
Prop1 G A 11: 50,951,060 P173L possibly damaging Het
Rabepk G A 2: 34,799,830 probably benign Het
Reln A G 5: 21,979,579 I1646T probably benign Het
Rexo1 A T 10: 80,550,261 L321Q probably damaging Het
Rfx3 T A 19: 27,806,325 E382V probably benign Het
Rnf20 C T 4: 49,648,437 T415I possibly damaging Het
Rpl10-ps3 T A 9: 50,344,778 D55V probably benign Het
Sag A G 1: 87,805,330 T7A probably benign Het
Saysd1 G A 14: 20,082,937 R51C probably damaging Het
Shprh T A 10: 11,164,830 Y682* probably null Het
Slc6a13 T C 6: 121,325,053 I198T probably damaging Het
Smyd5 C A 6: 85,438,847 C101* probably null Het
Spata31d1d A G 13: 59,726,607 V1038A probably benign Het
Stat6 T C 10: 127,658,642 S692P probably benign Het
Tbc1d9 A T 8: 83,271,551 M1246L probably benign Het
Tmprss5 T A 9: 49,114,594 probably null Het
Trim12a A T 7: 104,304,325 M193K probably benign Het
Ube2t T A 1: 134,971,920 L102H probably damaging Het
Ubr1 G A 2: 120,866,553 R1623W probably damaging Het
Ush2a T G 1: 188,444,653 M1338R probably damaging Het
Usp36 A T 11: 118,284,999 L112Q probably damaging Het
Vmn1r53 A G 6: 90,223,775 M189T probably benign Het
Vmn1r54 T C 6: 90,269,686 V194A probably benign Het
Vmn2r33 A G 7: 7,551,193 V787A probably damaging Het
Vps26a A G 10: 62,464,679 I236T probably damaging Het
Vwde A T 6: 13,195,997 L343Q probably damaging Het
Xdh A G 17: 73,898,374 V1032A probably damaging Het
Zan A G 5: 137,395,620 F4523S unknown Het
Zfand5 T A 19: 21,277,023 V66E probably benign Het
Zfp658 T A 7: 43,573,374 C358S possibly damaging Het
Zfp977 T A 7: 42,582,648 R64W probably damaging Het
Zfp995 C T 17: 21,880,191 S354N probably benign Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
Achilles UTSW 5 121307381 nonsense probably null
agamemnon UTSW 5 121253858 splice site probably benign
clymnestra UTSW 5 121334375 missense possibly damaging 0.86
hector UTSW 5 121315437 missense probably damaging 1.00
helen UTSW 5 121310663 missense probably damaging 0.97
Merriwether UTSW 5 121353551 missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 splice site probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 splice site probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121358133 splice site probably null
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
R7782:Hectd4 UTSW 5 121305721 missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121329568 missense probably benign 0.27
R7898:Hectd4 UTSW 5 121331817 missense probably benign 0.18
R7910:Hectd4 UTSW 5 121254228 missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121310629 missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121339518 missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121321398 missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121332949 missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121286376 missense probably benign 0.33
R8348:Hectd4 UTSW 5 121220256 start gained probably benign
R8397:Hectd4 UTSW 5 121259894 missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121308358 missense possibly damaging 0.90
R8436:Hectd4 UTSW 5 121343147 missense probably benign 0.00
R8443:Hectd4 UTSW 5 121329109 missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121220256 start gained probably benign
R8516:Hectd4 UTSW 5 121349010 missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121304426 nonsense probably null
R8553:Hectd4 UTSW 5 121353598 missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121310651 missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121350494 missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121363775 nonsense probably null
R8769:Hectd4 UTSW 5 121281873 missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121323931 missense probably benign 0.01
R8887:Hectd4 UTSW 5 121295478 missense probably benign 0.44
R8982:Hectd4 UTSW 5 121328242 missense probably benign 0.02
R8988:Hectd4 UTSW 5 121277756 missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121358284 missense probably benign 0.33
R8994:Hectd4 UTSW 5 121303566 missense probably benign 0.33
R9049:Hectd4 UTSW 5 121313892 missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121273614 missense probably benign 0.14
R9106:Hectd4 UTSW 5 121329556 missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121358175 missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121349034 missense probably benign 0.33
R9154:Hectd4 UTSW 5 121253904 missense
R9162:Hectd4 UTSW 5 121306979 missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121308627 missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121299488 missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121295433 missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121348965 missense probably benign 0.14
R9300:Hectd4 UTSW 5 121348889 missense probably benign 0.33
R9314:Hectd4 UTSW 5 121299645 critical splice donor site probably null
R9381:Hectd4 UTSW 5 121334429 missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121322801 missense probably benign 0.01
R9491:Hectd4 UTSW 5 121314918 missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121364553 missense probably benign 0.00
R9557:Hectd4 UTSW 5 121321554 missense not run
R9561:Hectd4 UTSW 5 121334469 missense not run
R9593:Hectd4 UTSW 5 121286781 nonsense probably null
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Z1177:Hectd4 UTSW 5 121358320 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTTATTCAGTCCCAGAGTAG -3'
(R):5'- CTGTCATTACAGCAGAGCAGC -3'

Sequencing Primer
(F):5'- CCTCTGTAACATAACTGCTGAGGTG -3'
(R):5'- TTACAGCAGAGCAGCACACC -3'
Posted On 2021-10-11