Incidental Mutation 'R8995:Slc6a13'
ID 684662
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission 068826-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.738) question?
Stock # R8995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121302012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 198 (I198T)
Ref Sequence ENSEMBL: ENSMUSP00000066779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
AlphaFold P31649
Predicted Effect probably damaging
Transcript: ENSMUST00000064580
AA Change: I198T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: I198T

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142419
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 122,257,764 (GRCm39) *214R probably null Het
Acd A G 8: 106,427,131 (GRCm39) L93P probably damaging Het
Adgrv1 GTT GT 13: 81,553,457 (GRCm39) probably null Het
Aldh1b1 T A 4: 45,803,413 (GRCm39) M317K possibly damaging Het
Arfgap2 C A 2: 91,103,929 (GRCm39) Q342K probably damaging Het
Arhgef16 C T 4: 154,371,495 (GRCm39) E233K probably damaging Het
Asxl1 C T 2: 153,235,886 (GRCm39) R323C probably damaging Het
Bank1 G T 3: 135,772,264 (GRCm39) D656E possibly damaging Het
Bdh2 A G 3: 135,000,989 (GRCm39) M120V probably damaging Het
Bend7 A G 2: 4,749,103 (GRCm39) I73M probably damaging Het
Cd207 C A 6: 83,652,891 (GRCm39) D80Y probably damaging Het
Cdon A G 9: 35,398,093 (GRCm39) T937A probably damaging Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Csnk2a1-ps3 T A 1: 156,352,873 (GRCm39) V358E probably benign Het
Ddx50 A G 10: 62,469,862 (GRCm39) I375T probably damaging Het
Dhrs1 T A 14: 55,977,396 (GRCm39) T241S probably benign Het
Eef1b2 T C 1: 63,217,629 (GRCm39) Y79H probably damaging Het
Elmod2 A G 8: 84,049,315 (GRCm39) C84R probably benign Het
Exo1 A G 1: 175,736,127 (GRCm39) H837R probably benign Het
Fat3 T C 9: 16,286,898 (GRCm39) N875S probably damaging Het
Flvcr1 A T 1: 190,743,817 (GRCm39) L413Q probably damaging Het
Fras1 G T 5: 96,860,415 (GRCm39) V2154F possibly damaging Het
Golm2 A C 2: 121,756,199 (GRCm39) E409D probably damaging Het
Hectd4 G A 5: 121,392,422 (GRCm39) V229M possibly damaging Het
Ifitm6 A T 7: 140,596,617 (GRCm39) V52E probably damaging Het
Igkv4-58 A G 6: 69,477,511 (GRCm39) S29P probably damaging Het
Klc1 G A 12: 111,743,344 (GRCm39) A224T probably damaging Het
Knl1 T C 2: 118,902,990 (GRCm39) S1564P probably benign Het
Krt25 T C 11: 99,207,382 (GRCm39) D399G probably benign Het
Lamc1 T C 1: 153,207,993 (GRCm39) Q98R probably benign Het
Lpar1 T A 4: 58,486,954 (GRCm39) M106L probably damaging Het
Mpc1 A G 17: 8,502,784 (GRCm39) Y21C probably benign Het
Msr1 T A 8: 40,042,460 (GRCm39) I372F possibly damaging Het
Ndc80 T C 17: 71,815,598 (GRCm39) N396D probably benign Het
Nphp4 G A 4: 152,623,345 (GRCm39) R673H probably damaging Het
Nsd3 T C 8: 26,131,169 (GRCm39) F178S probably damaging Het
Or1p1b A T 11: 74,130,620 (GRCm39) T77S probably benign Het
Or8g54 T C 9: 39,707,313 (GRCm39) I214T possibly damaging Het
Pcdhgb7 T A 18: 37,885,230 (GRCm39) F133L probably damaging Het
Pikfyve A G 1: 65,244,746 (GRCm39) probably null Het
Pld5 A T 1: 175,791,580 (GRCm39) D475E probably benign Het
Potefam3f A T 8: 20,479,025 (GRCm39) H11L Het
Prop1 G A 11: 50,841,887 (GRCm39) P173L possibly damaging Het
Rabepk G A 2: 34,689,842 (GRCm39) probably benign Het
Reln A G 5: 22,184,577 (GRCm39) I1646T probably benign Het
Rexo1 A T 10: 80,386,095 (GRCm39) L321Q probably damaging Het
Rfx3 T A 19: 27,783,725 (GRCm39) E382V probably benign Het
Rnf20 C T 4: 49,648,437 (GRCm39) T415I possibly damaging Het
Rpl10-ps3 T A 9: 50,256,078 (GRCm39) D55V probably benign Het
Sag A G 1: 87,733,052 (GRCm39) T7A probably benign Het
Saysd1 G A 14: 20,133,005 (GRCm39) R51C probably damaging Het
Shprh T A 10: 11,040,574 (GRCm39) Y682* probably null Het
Slx9 G A 10: 77,333,303 (GRCm39) R121* probably null Het
Smyd5 C A 6: 85,415,829 (GRCm39) C101* probably null Het
Spata31d1d A G 13: 59,874,421 (GRCm39) V1038A probably benign Het
Stat6 T C 10: 127,494,511 (GRCm39) S692P probably benign Het
Tbc1d9 A T 8: 83,998,180 (GRCm39) M1246L probably benign Het
Tmprss5 T A 9: 49,025,894 (GRCm39) probably null Het
Trim12a A T 7: 103,953,532 (GRCm39) M193K probably benign Het
Ube2t T A 1: 134,899,658 (GRCm39) L102H probably damaging Het
Ubr1 G A 2: 120,697,034 (GRCm39) R1623W probably damaging Het
Ush2a T G 1: 188,176,850 (GRCm39) M1338R probably damaging Het
Usp36 A T 11: 118,175,825 (GRCm39) L112Q probably damaging Het
Vmn1r53 A G 6: 90,200,757 (GRCm39) M189T probably benign Het
Vmn1r54 T C 6: 90,246,668 (GRCm39) V194A probably benign Het
Vmn2r33 A G 7: 7,554,192 (GRCm39) V787A probably damaging Het
Vps26a A G 10: 62,300,458 (GRCm39) I236T probably damaging Het
Vwde A T 6: 13,195,996 (GRCm39) L343Q probably damaging Het
Xdh A G 17: 74,205,369 (GRCm39) V1032A probably damaging Het
Zan A G 5: 137,393,882 (GRCm39) F4523S unknown Het
Zfand5 T A 19: 21,254,387 (GRCm39) V66E probably benign Het
Zfp658 T A 7: 43,222,798 (GRCm39) C358S possibly damaging Het
Zfp977 T A 7: 42,232,072 (GRCm39) R64W probably damaging Het
Zfp995 C T 17: 22,099,172 (GRCm39) S354N probably benign Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121,301,262 (GRCm39) missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121,302,104 (GRCm39) missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121,279,700 (GRCm39) missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121,311,450 (GRCm39) missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R9104:Slc6a13 UTSW 6 121,313,044 (GRCm39) missense probably benign
R9168:Slc6a13 UTSW 6 121,302,042 (GRCm39) missense probably damaging 1.00
R9235:Slc6a13 UTSW 6 121,301,984 (GRCm39) missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AACGTTCATAGCCCTGGGTTC -3'
(R):5'- GGAAGGAAGCCACATGAACTCC -3'

Sequencing Primer
(F):5'- CTGGGTTCTAACCCTTACAC -3'
(R):5'- TGCCTGGACCAGCCTAAAG -3'
Posted On 2021-10-11