Mutagenetix > Incidental Mutation

Incidental Mutation 'R8995:Shprh'

684680

Institutional Source

Beutler Lab

Gene Symbol

Shprh

Ensembl Gene

ENSMUSG00000090112

Gene Name

SNF2 histone linker PHD RING helicase

Synonyms

2610103K11Rik, D230017O13Rik

MMRRC Submission

068826-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8995 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11149427-11217595 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 11164830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 682 (Y682*)

Ref Sequence

ENSEMBL: ENSMUSP00000039422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]

AlphaFold

Q7TPQ3

Predicted Effect

probably null
Transcript: ENSMUST00000044053
AA Change: Y682*

SMART Domains

Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: Y682*

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
Pfam:Helicase_C	1500	1613	1.6e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000054814
AA Change: Y682*

SMART Domains

Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: Y682*

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1616	6e-8	SMART
Blast:HELICc	1533	1613	4e-46	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000159541
AA Change: Y682*

SMART Domains

Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: Y682*

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1619	4e-8	SMART
Blast:HELICc	1533	1613	6e-46	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000159810
AA Change: Y682*

SMART Domains

Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: Y682*

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	2e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
Blast:DEXDc	948	1026	2e-9	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000160461
AA Change: Y162*

SMART Domains

Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112
AA Change: Y162*

Domain	Start	End	E-Value	Type
PHD	131	178	2.33e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	A	G	8: 121,531,025	*214R	probably null	Het
Acd	A	G	8: 105,700,499	L93P	probably damaging	Het
Adgrv1	GTT	GT	13: 81,405,338		probably null	Het
Aldh1b1	T	A	4: 45,803,413	M317K	possibly damaging	Het
Arfgap2	C	A	2: 91,273,584	Q342K	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Asxl1	C	T	2: 153,393,966	R323C	probably damaging	Het
Bank1	G	T	3: 136,066,503	D656E	possibly damaging	Het
Bdh2	A	G	3: 135,295,228	M120V	probably damaging	Het
Bend7	A	G	2: 4,744,292	I73M	probably damaging	Het
Casc4	A	C	2: 121,925,718	E409D	probably damaging	Het
Cd207	C	A	6: 83,675,909	D80Y	probably damaging	Het
Cdon	A	G	9: 35,486,797	T937A	probably damaging	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Ddx50	A	G	10: 62,634,083	I375T	probably damaging	Het
Dhrs1	T	A	14: 55,739,939	T241S	probably benign	Het
Eef1b2	T	C	1: 63,178,470	Y79H	probably damaging	Het
Elmod2	A	G	8: 83,322,686	C84R	probably benign	Het
Exo1	A	G	1: 175,908,561	H837R	probably benign	Het
Fam207a	G	A	10: 77,497,469	R121*	probably null	Het
Fat3	T	C	9: 16,375,602	N875S	probably damaging	Het
Flvcr1	A	T	1: 191,011,620	L413Q	probably damaging	Het
Fras1	G	T	5: 96,712,556	V2154F	possibly damaging	Het
Gm10031	T	A	1: 156,525,303	V358E	probably benign	Het
Gm31371	A	T	8: 19,903,424	H11L		Het
Hectd4	G	A	5: 121,254,359	V229M	possibly damaging	Het
Ifitm6	A	T	7: 141,016,704	V52E	probably damaging	Het
Igkv4-58	A	G	6: 69,500,527	S29P	probably damaging	Het
Klc1	G	A	12: 111,776,910	A224T	probably damaging	Het
Knl1	T	C	2: 119,072,509	S1564P	probably benign	Het
Krt25	T	C	11: 99,316,556	D399G	probably benign	Het
Lamc1	T	C	1: 153,332,247	Q98R	probably benign	Het
Lpar1	T	A	4: 58,486,954	M106L	probably damaging	Het
Mpc1	A	G	17: 8,283,952	Y21C	probably benign	Het
Msr1	T	A	8: 39,589,419	I372F	possibly damaging	Het
Ndc80	T	C	17: 71,508,603	N396D	probably benign	Het
Nphp4	G	A	4: 152,538,888	R673H	probably damaging	Het
Nsd3	T	C	8: 25,641,153	F178S	probably damaging	Het
Olfr404-ps1	A	T	11: 74,239,794	T77S	probably benign	Het
Olfr969	T	C	9: 39,796,017	I214T	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,177	F133L	probably damaging	Het
Pikfyve	A	G	1: 65,205,587		probably null	Het
Pld5	A	T	1: 175,964,014	D475E	probably benign	Het
Prop1	G	A	11: 50,951,060	P173L	possibly damaging	Het
Rabepk	G	A	2: 34,799,830		probably benign	Het
Reln	A	G	5: 21,979,579	I1646T	probably benign	Het
Rexo1	A	T	10: 80,550,261	L321Q	probably damaging	Het
Rfx3	T	A	19: 27,806,325	E382V	probably benign	Het
Rnf20	C	T	4: 49,648,437	T415I	possibly damaging	Het
Rpl10-ps3	T	A	9: 50,344,778	D55V	probably benign	Het
Sag	A	G	1: 87,805,330	T7A	probably benign	Het
Saysd1	G	A	14: 20,082,937	R51C	probably damaging	Het
Slc6a13	T	C	6: 121,325,053	I198T	probably damaging	Het
Smyd5	C	A	6: 85,438,847	C101*	probably null	Het
Spata31d1d	A	G	13: 59,726,607	V1038A	probably benign	Het
Stat6	T	C	10: 127,658,642	S692P	probably benign	Het
Tbc1d9	A	T	8: 83,271,551	M1246L	probably benign	Het
Tmprss5	T	A	9: 49,114,594		probably null	Het
Trim12a	A	T	7: 104,304,325	M193K	probably benign	Het
Ube2t	T	A	1: 134,971,920	L102H	probably damaging	Het
Ubr1	G	A	2: 120,866,553	R1623W	probably damaging	Het
Ush2a	T	G	1: 188,444,653	M1338R	probably damaging	Het
Usp36	A	T	11: 118,284,999	L112Q	probably damaging	Het
Vmn1r53	A	G	6: 90,223,775	M189T	probably benign	Het
Vmn1r54	T	C	6: 90,269,686	V194A	probably benign	Het
Vmn2r33	A	G	7: 7,551,193	V787A	probably damaging	Het
Vps26a	A	G	10: 62,464,679	I236T	probably damaging	Het
Vwde	A	T	6: 13,195,997	L343Q	probably damaging	Het
Xdh	A	G	17: 73,898,374	V1032A	probably damaging	Het
Zan	A	G	5: 137,395,620	F4523S	unknown	Het
Zfand5	T	A	19: 21,277,023	V66E	probably benign	Het
Zfp658	T	A	7: 43,573,374	C358S	possibly damaging	Het
Zfp977	T	A	7: 42,582,648	R64W	probably damaging	Het
Zfp995	C	T	17: 21,880,191	S354N	probably benign	Het

Other mutations in Shprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Shprh	APN	10	11188158	missense	probably damaging	1.00
IGL00583:Shprh	APN	10	11188020	missense	probably benign	0.37
IGL00684:Shprh	APN	10	11163037	missense	probably benign	0.11
IGL01295:Shprh	APN	10	11183868	missense	probably damaging	0.96
IGL01387:Shprh	APN	10	11170254	missense	probably damaging	1.00
IGL01635:Shprh	APN	10	11170019	nonsense	probably null
IGL01833:Shprh	APN	10	11191062	missense	probably damaging	1.00
IGL02013:Shprh	APN	10	11181502	splice site	probably benign
IGL02502:Shprh	APN	10	11194357	missense	possibly damaging	0.66
IGL02819:Shprh	APN	10	11154765	missense	possibly damaging	0.93
PIT4581001:Shprh	UTSW	10	11192494	frame shift	probably null
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0255:Shprh	UTSW	10	11186391	missense	possibly damaging	0.92
R0325:Shprh	UTSW	10	11170109	missense	probably benign	0.00
R0331:Shprh	UTSW	10	11194170	splice site	probably benign
R0494:Shprh	UTSW	10	11157191	missense	probably damaging	1.00
R0532:Shprh	UTSW	10	11162812	missense	possibly damaging	0.90
R0546:Shprh	UTSW	10	11183887	splice site	probably benign
R0574:Shprh	UTSW	10	11163077	unclassified	probably benign
R0605:Shprh	UTSW	10	11207112	missense	probably damaging	1.00
R0662:Shprh	UTSW	10	11186847	missense	probably damaging	1.00
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1263:Shprh	UTSW	10	11159530	missense	probably damaging	1.00
R1588:Shprh	UTSW	10	11164744	missense	probably damaging	1.00
R1638:Shprh	UTSW	10	11157078	missense	probably benign
R1830:Shprh	UTSW	10	11186911	splice site	probably null
R1898:Shprh	UTSW	10	11186869	missense	probably damaging	1.00
R1903:Shprh	UTSW	10	11183797	nonsense	probably null
R2060:Shprh	UTSW	10	11152120	missense	probably benign	0.03
R2225:Shprh	UTSW	10	11162235	unclassified	probably benign
R2363:Shprh	UTSW	10	11171953	missense	probably damaging	1.00
R2509:Shprh	UTSW	10	11166724	missense	probably damaging	1.00
R2891:Shprh	UTSW	10	11164356	missense	probably damaging	1.00
R3077:Shprh	UTSW	10	11170413	missense	probably damaging	1.00
R3150:Shprh	UTSW	10	11170030	missense	probably damaging	0.97
R3796:Shprh	UTSW	10	11178757	missense	possibly damaging	0.89
R4196:Shprh	UTSW	10	11207860	utr 3 prime	probably benign
R4423:Shprh	UTSW	10	11186518	missense	possibly damaging	0.82
R4488:Shprh	UTSW	10	11160471	missense	probably benign	0.17
R4748:Shprh	UTSW	10	11170476	missense	probably damaging	1.00
R4768:Shprh	UTSW	10	11181540	missense	probably damaging	0.96
R4867:Shprh	UTSW	10	11164557	missense	probably benign	0.00
R4937:Shprh	UTSW	10	11157119	missense	probably benign
R5140:Shprh	UTSW	10	11154705	missense	probably benign	0.03
R5318:Shprh	UTSW	10	11166557	missense	probably benign	0.04
R5323:Shprh	UTSW	10	11170297	splice site	probably null
R5450:Shprh	UTSW	10	11212330	missense	possibly damaging	0.70
R5872:Shprh	UTSW	10	11188073	missense	probably damaging	1.00
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6392:Shprh	UTSW	10	11178741	nonsense	probably null
R6416:Shprh	UTSW	10	11167873	missense	probably damaging	1.00
R6470:Shprh	UTSW	10	11171937	missense	probably damaging	0.98
R6513:Shprh	UTSW	10	11186893	missense	probably damaging	1.00
R6530:Shprh	UTSW	10	11194267	missense	probably benign	0.02
R6678:Shprh	UTSW	10	11166545	missense	probably benign	0.16
R6757:Shprh	UTSW	10	11181508	splice site	probably null
R6971:Shprh	UTSW	10	11166693	missense	probably damaging	1.00
R7158:Shprh	UTSW	10	11166730	missense	probably damaging	0.98
R7582:Shprh	UTSW	10	11164705	missense	probably benign
R7757:Shprh	UTSW	10	11162180	missense	probably benign	0.30
R7812:Shprh	UTSW	10	11151991	missense	probably benign
R7998:Shprh	UTSW	10	11185341	missense	probably damaging	1.00
R8061:Shprh	UTSW	10	11212333	missense	possibly damaging	0.71
R8082:Shprh	UTSW	10	11151811	missense	probably benign	0.22
R8116:Shprh	UTSW	10	11213461	missense	probably damaging	0.99
R8390:Shprh	UTSW	10	11187983	missense	possibly damaging	0.92
R8445:Shprh	UTSW	10	11181569	missense	possibly damaging	0.92
R8530:Shprh	UTSW	10	11151934	missense	probably benign	0.37
R8759:Shprh	UTSW	10	11157164	missense	possibly damaging	0.92
R8937:Shprh	UTSW	10	11185437	missense	possibly damaging	0.60
R9053:Shprh	UTSW	10	11154702	missense	probably benign	0.04
R9131:Shprh	UTSW	10	11162845	missense	possibly damaging	0.58
R9176:Shprh	UTSW	10	11160576	missense	probably benign	0.02
R9391:Shprh	UTSW	10	11162889	missense	probably benign	0.05
R9423:Shprh	UTSW	10	11205263	missense	probably damaging	1.00
R9563:Shprh	UTSW	10	11166491	nonsense	probably null
R9668:Shprh	UTSW	10	11206332	missense	probably damaging	0.97
R9709:Shprh	UTSW	10	11162830	missense	possibly damaging	0.91
R9718:Shprh	UTSW	10	11213504	missense	probably damaging	1.00
R9750:Shprh	UTSW	10	11164460	missense	probably damaging	0.98
RF012:Shprh	UTSW	10	11164841	missense	probably benign	0.02
V8831:Shprh	UTSW	10	11186862	missense	probably damaging	1.00
Z1176:Shprh	UTSW	10	11164553	missense	probably benign
Z1176:Shprh	UTSW	10	11186447	missense	probably damaging	1.00
Z1177:Shprh	UTSW	10	11151762	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AAAAGACTGTGCTGAGTCGC -3'
(R):5'- AAGCACCACTGTACAGGTTC -3'

Sequencing Primer
(F):5'- ACTGTGCTGAGTCGCCAAAC -3'
(R):5'- TAGCTGCAGTGCCTTACCAG -3'

Posted On

2021-10-11