Incidental Mutation 'R8995:Usp36'
ID 684689
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission 068826-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R8995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118175825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 112 (L112Q)
Ref Sequence ENSEMBL: ENSMUSP00000090036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000092382
AA Change: L112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: L112Q

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106296
AA Change: L112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: L112Q

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144153
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 122,257,764 (GRCm39) *214R probably null Het
Acd A G 8: 106,427,131 (GRCm39) L93P probably damaging Het
Adgrv1 GTT GT 13: 81,553,457 (GRCm39) probably null Het
Aldh1b1 T A 4: 45,803,413 (GRCm39) M317K possibly damaging Het
Arfgap2 C A 2: 91,103,929 (GRCm39) Q342K probably damaging Het
Arhgef16 C T 4: 154,371,495 (GRCm39) E233K probably damaging Het
Asxl1 C T 2: 153,235,886 (GRCm39) R323C probably damaging Het
Bank1 G T 3: 135,772,264 (GRCm39) D656E possibly damaging Het
Bdh2 A G 3: 135,000,989 (GRCm39) M120V probably damaging Het
Bend7 A G 2: 4,749,103 (GRCm39) I73M probably damaging Het
Cd207 C A 6: 83,652,891 (GRCm39) D80Y probably damaging Het
Cdon A G 9: 35,398,093 (GRCm39) T937A probably damaging Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Csnk2a1-ps3 T A 1: 156,352,873 (GRCm39) V358E probably benign Het
Ddx50 A G 10: 62,469,862 (GRCm39) I375T probably damaging Het
Dhrs1 T A 14: 55,977,396 (GRCm39) T241S probably benign Het
Eef1b2 T C 1: 63,217,629 (GRCm39) Y79H probably damaging Het
Elmod2 A G 8: 84,049,315 (GRCm39) C84R probably benign Het
Exo1 A G 1: 175,736,127 (GRCm39) H837R probably benign Het
Fat3 T C 9: 16,286,898 (GRCm39) N875S probably damaging Het
Flvcr1 A T 1: 190,743,817 (GRCm39) L413Q probably damaging Het
Fras1 G T 5: 96,860,415 (GRCm39) V2154F possibly damaging Het
Golm2 A C 2: 121,756,199 (GRCm39) E409D probably damaging Het
Hectd4 G A 5: 121,392,422 (GRCm39) V229M possibly damaging Het
Ifitm6 A T 7: 140,596,617 (GRCm39) V52E probably damaging Het
Igkv4-58 A G 6: 69,477,511 (GRCm39) S29P probably damaging Het
Klc1 G A 12: 111,743,344 (GRCm39) A224T probably damaging Het
Knl1 T C 2: 118,902,990 (GRCm39) S1564P probably benign Het
Krt25 T C 11: 99,207,382 (GRCm39) D399G probably benign Het
Lamc1 T C 1: 153,207,993 (GRCm39) Q98R probably benign Het
Lpar1 T A 4: 58,486,954 (GRCm39) M106L probably damaging Het
Mpc1 A G 17: 8,502,784 (GRCm39) Y21C probably benign Het
Msr1 T A 8: 40,042,460 (GRCm39) I372F possibly damaging Het
Ndc80 T C 17: 71,815,598 (GRCm39) N396D probably benign Het
Nphp4 G A 4: 152,623,345 (GRCm39) R673H probably damaging Het
Nsd3 T C 8: 26,131,169 (GRCm39) F178S probably damaging Het
Or1p1b A T 11: 74,130,620 (GRCm39) T77S probably benign Het
Or8g54 T C 9: 39,707,313 (GRCm39) I214T possibly damaging Het
Pcdhgb7 T A 18: 37,885,230 (GRCm39) F133L probably damaging Het
Pikfyve A G 1: 65,244,746 (GRCm39) probably null Het
Pld5 A T 1: 175,791,580 (GRCm39) D475E probably benign Het
Potefam3f A T 8: 20,479,025 (GRCm39) H11L Het
Prop1 G A 11: 50,841,887 (GRCm39) P173L possibly damaging Het
Rabepk G A 2: 34,689,842 (GRCm39) probably benign Het
Reln A G 5: 22,184,577 (GRCm39) I1646T probably benign Het
Rexo1 A T 10: 80,386,095 (GRCm39) L321Q probably damaging Het
Rfx3 T A 19: 27,783,725 (GRCm39) E382V probably benign Het
Rnf20 C T 4: 49,648,437 (GRCm39) T415I possibly damaging Het
Rpl10-ps3 T A 9: 50,256,078 (GRCm39) D55V probably benign Het
Sag A G 1: 87,733,052 (GRCm39) T7A probably benign Het
Saysd1 G A 14: 20,133,005 (GRCm39) R51C probably damaging Het
Shprh T A 10: 11,040,574 (GRCm39) Y682* probably null Het
Slc6a13 T C 6: 121,302,012 (GRCm39) I198T probably damaging Het
Slx9 G A 10: 77,333,303 (GRCm39) R121* probably null Het
Smyd5 C A 6: 85,415,829 (GRCm39) C101* probably null Het
Spata31d1d A G 13: 59,874,421 (GRCm39) V1038A probably benign Het
Stat6 T C 10: 127,494,511 (GRCm39) S692P probably benign Het
Tbc1d9 A T 8: 83,998,180 (GRCm39) M1246L probably benign Het
Tmprss5 T A 9: 49,025,894 (GRCm39) probably null Het
Trim12a A T 7: 103,953,532 (GRCm39) M193K probably benign Het
Ube2t T A 1: 134,899,658 (GRCm39) L102H probably damaging Het
Ubr1 G A 2: 120,697,034 (GRCm39) R1623W probably damaging Het
Ush2a T G 1: 188,176,850 (GRCm39) M1338R probably damaging Het
Vmn1r53 A G 6: 90,200,757 (GRCm39) M189T probably benign Het
Vmn1r54 T C 6: 90,246,668 (GRCm39) V194A probably benign Het
Vmn2r33 A G 7: 7,554,192 (GRCm39) V787A probably damaging Het
Vps26a A G 10: 62,300,458 (GRCm39) I236T probably damaging Het
Vwde A T 6: 13,195,996 (GRCm39) L343Q probably damaging Het
Xdh A G 17: 74,205,369 (GRCm39) V1032A probably damaging Het
Zan A G 5: 137,393,882 (GRCm39) F4523S unknown Het
Zfand5 T A 19: 21,254,387 (GRCm39) V66E probably benign Het
Zfp658 T A 7: 43,222,798 (GRCm39) C358S possibly damaging Het
Zfp977 T A 7: 42,232,072 (GRCm39) R64W probably damaging Het
Zfp995 C T 17: 22,099,172 (GRCm39) S354N probably benign Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0606:Usp36 UTSW 11 118,153,854 (GRCm39) splice site probably benign
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R1886:Usp36 UTSW 11 118,163,784 (GRCm39) missense probably damaging 1.00
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3768:Usp36 UTSW 11 118,153,878 (GRCm39) missense probably damaging 1.00
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R7843:Usp36 UTSW 11 118,176,791 (GRCm39) missense probably damaging 1.00
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R9024:Usp36 UTSW 11 118,166,983 (GRCm39) missense possibly damaging 0.95
R9325:Usp36 UTSW 11 118,160,031 (GRCm39) missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
R9774:Usp36 UTSW 11 118,153,875 (GRCm39) missense probably damaging 1.00
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTAACAAGTTCAGCTGACTC -3'
(R):5'- ATACAGAGGTTGGACGGGTC -3'

Sequencing Primer
(F):5'- TGACTCACAGCAAAGCCCAG -3'
(R):5'- CACACAGTGCGGTGCAAG -3'
Posted On 2021-10-11