Incidental Mutation 'R8995:Xdh'
ID 684699
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 068826-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R8995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74205369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1032 (V1032A)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: V1032A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V1032A

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 122,257,764 (GRCm39) *214R probably null Het
Acd A G 8: 106,427,131 (GRCm39) L93P probably damaging Het
Adgrv1 GTT GT 13: 81,553,457 (GRCm39) probably null Het
Aldh1b1 T A 4: 45,803,413 (GRCm39) M317K possibly damaging Het
Arfgap2 C A 2: 91,103,929 (GRCm39) Q342K probably damaging Het
Arhgef16 C T 4: 154,371,495 (GRCm39) E233K probably damaging Het
Asxl1 C T 2: 153,235,886 (GRCm39) R323C probably damaging Het
Bank1 G T 3: 135,772,264 (GRCm39) D656E possibly damaging Het
Bdh2 A G 3: 135,000,989 (GRCm39) M120V probably damaging Het
Bend7 A G 2: 4,749,103 (GRCm39) I73M probably damaging Het
Cd207 C A 6: 83,652,891 (GRCm39) D80Y probably damaging Het
Cdon A G 9: 35,398,093 (GRCm39) T937A probably damaging Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Csnk2a1-ps3 T A 1: 156,352,873 (GRCm39) V358E probably benign Het
Ddx50 A G 10: 62,469,862 (GRCm39) I375T probably damaging Het
Dhrs1 T A 14: 55,977,396 (GRCm39) T241S probably benign Het
Eef1b2 T C 1: 63,217,629 (GRCm39) Y79H probably damaging Het
Elmod2 A G 8: 84,049,315 (GRCm39) C84R probably benign Het
Exo1 A G 1: 175,736,127 (GRCm39) H837R probably benign Het
Fat3 T C 9: 16,286,898 (GRCm39) N875S probably damaging Het
Flvcr1 A T 1: 190,743,817 (GRCm39) L413Q probably damaging Het
Fras1 G T 5: 96,860,415 (GRCm39) V2154F possibly damaging Het
Golm2 A C 2: 121,756,199 (GRCm39) E409D probably damaging Het
Hectd4 G A 5: 121,392,422 (GRCm39) V229M possibly damaging Het
Ifitm6 A T 7: 140,596,617 (GRCm39) V52E probably damaging Het
Igkv4-58 A G 6: 69,477,511 (GRCm39) S29P probably damaging Het
Klc1 G A 12: 111,743,344 (GRCm39) A224T probably damaging Het
Knl1 T C 2: 118,902,990 (GRCm39) S1564P probably benign Het
Krt25 T C 11: 99,207,382 (GRCm39) D399G probably benign Het
Lamc1 T C 1: 153,207,993 (GRCm39) Q98R probably benign Het
Lpar1 T A 4: 58,486,954 (GRCm39) M106L probably damaging Het
Mpc1 A G 17: 8,502,784 (GRCm39) Y21C probably benign Het
Msr1 T A 8: 40,042,460 (GRCm39) I372F possibly damaging Het
Ndc80 T C 17: 71,815,598 (GRCm39) N396D probably benign Het
Nphp4 G A 4: 152,623,345 (GRCm39) R673H probably damaging Het
Nsd3 T C 8: 26,131,169 (GRCm39) F178S probably damaging Het
Or1p1b A T 11: 74,130,620 (GRCm39) T77S probably benign Het
Or8g54 T C 9: 39,707,313 (GRCm39) I214T possibly damaging Het
Pcdhgb7 T A 18: 37,885,230 (GRCm39) F133L probably damaging Het
Pikfyve A G 1: 65,244,746 (GRCm39) probably null Het
Pld5 A T 1: 175,791,580 (GRCm39) D475E probably benign Het
Potefam3f A T 8: 20,479,025 (GRCm39) H11L Het
Prop1 G A 11: 50,841,887 (GRCm39) P173L possibly damaging Het
Rabepk G A 2: 34,689,842 (GRCm39) probably benign Het
Reln A G 5: 22,184,577 (GRCm39) I1646T probably benign Het
Rexo1 A T 10: 80,386,095 (GRCm39) L321Q probably damaging Het
Rfx3 T A 19: 27,783,725 (GRCm39) E382V probably benign Het
Rnf20 C T 4: 49,648,437 (GRCm39) T415I possibly damaging Het
Rpl10-ps3 T A 9: 50,256,078 (GRCm39) D55V probably benign Het
Sag A G 1: 87,733,052 (GRCm39) T7A probably benign Het
Saysd1 G A 14: 20,133,005 (GRCm39) R51C probably damaging Het
Shprh T A 10: 11,040,574 (GRCm39) Y682* probably null Het
Slc6a13 T C 6: 121,302,012 (GRCm39) I198T probably damaging Het
Slx9 G A 10: 77,333,303 (GRCm39) R121* probably null Het
Smyd5 C A 6: 85,415,829 (GRCm39) C101* probably null Het
Spata31d1d A G 13: 59,874,421 (GRCm39) V1038A probably benign Het
Stat6 T C 10: 127,494,511 (GRCm39) S692P probably benign Het
Tbc1d9 A T 8: 83,998,180 (GRCm39) M1246L probably benign Het
Tmprss5 T A 9: 49,025,894 (GRCm39) probably null Het
Trim12a A T 7: 103,953,532 (GRCm39) M193K probably benign Het
Ube2t T A 1: 134,899,658 (GRCm39) L102H probably damaging Het
Ubr1 G A 2: 120,697,034 (GRCm39) R1623W probably damaging Het
Ush2a T G 1: 188,176,850 (GRCm39) M1338R probably damaging Het
Usp36 A T 11: 118,175,825 (GRCm39) L112Q probably damaging Het
Vmn1r53 A G 6: 90,200,757 (GRCm39) M189T probably benign Het
Vmn1r54 T C 6: 90,246,668 (GRCm39) V194A probably benign Het
Vmn2r33 A G 7: 7,554,192 (GRCm39) V787A probably damaging Het
Vps26a A G 10: 62,300,458 (GRCm39) I236T probably damaging Het
Vwde A T 6: 13,195,996 (GRCm39) L343Q probably damaging Het
Zan A G 5: 137,393,882 (GRCm39) F4523S unknown Het
Zfand5 T A 19: 21,254,387 (GRCm39) V66E probably benign Het
Zfp658 T A 7: 43,222,798 (GRCm39) C358S possibly damaging Het
Zfp977 T A 7: 42,232,072 (GRCm39) R64W probably damaging Het
Zfp995 C T 17: 22,099,172 (GRCm39) S354N probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTACGGCCATGTGTGATG -3'
(R):5'- TCTCTAACTCCTGAAGGGCTAG -3'

Sequencing Primer
(F):5'- ATGTTTTCTCAGGCCTGATGC -3'
(R):5'- CAAATGTTGTGGTTGGCC -3'
Posted On 2021-10-11