Incidental Mutation 'R8995:Xdh'
ID684699
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R8995 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73898374 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1032 (V1032A)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: V1032A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V1032A

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A G 8: 121,531,025 *214R probably null Het
Acd A G 8: 105,700,499 L93P probably damaging Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Aldh1b1 T A 4: 45,803,413 M317K possibly damaging Het
Arfgap2 C A 2: 91,273,584 Q342K probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Asxl1 C T 2: 153,393,966 R323C probably damaging Het
Bank1 G T 3: 136,066,503 D656E possibly damaging Het
Bdh2 A G 3: 135,295,228 M120V probably damaging Het
Bend7 A G 2: 4,744,292 I73M probably damaging Het
Casc4 A C 2: 121,925,718 E409D probably damaging Het
Cd207 C A 6: 83,675,909 D80Y probably damaging Het
Cdon A G 9: 35,486,797 T937A probably damaging Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Ddx50 A G 10: 62,634,083 I375T probably damaging Het
Dhrs1 T A 14: 55,739,939 T241S probably benign Het
Eef1b2 T C 1: 63,178,470 Y79H probably damaging Het
Elmod2 A G 8: 83,322,686 C84R probably benign Het
Exo1 A G 1: 175,908,561 H837R probably benign Het
Fam207a G A 10: 77,497,469 R121* probably null Het
Fat3 T C 9: 16,375,602 N875S probably damaging Het
Flvcr1 A T 1: 191,011,620 L413Q probably damaging Het
Fras1 G T 5: 96,712,556 V2154F possibly damaging Het
Gm10031 T A 1: 156,525,303 V358E probably benign Het
Gm31371 A T 8: 19,903,424 H11L Het
Hectd4 G A 5: 121,254,359 V229M possibly damaging Het
Ifitm6 A T 7: 141,016,704 V52E probably damaging Het
Igkv4-58 A G 6: 69,500,527 S29P probably damaging Het
Klc1 G A 12: 111,776,910 A224T probably damaging Het
Knl1 T C 2: 119,072,509 S1564P probably benign Het
Krt25 T C 11: 99,316,556 D399G probably benign Het
Lamc1 T C 1: 153,332,247 Q98R probably benign Het
Lpar1 T A 4: 58,486,954 M106L probably damaging Het
Mpc1 A G 17: 8,283,952 Y21C probably benign Het
Msr1 T A 8: 39,589,419 I372F possibly damaging Het
Ndc80 T C 17: 71,508,603 N396D probably benign Het
Nphp4 G A 4: 152,538,888 R673H probably damaging Het
Nsd3 T C 8: 25,641,153 F178S probably damaging Het
Olfr404-ps1 A T 11: 74,239,794 T77S probably benign Het
Olfr969 T C 9: 39,796,017 I214T possibly damaging Het
Pcdhgb7 T A 18: 37,752,177 F133L probably damaging Het
Pikfyve A G 1: 65,205,587 probably null Het
Pld5 A T 1: 175,964,014 D475E probably benign Het
Prop1 G A 11: 50,951,060 P173L possibly damaging Het
Rabepk G A 2: 34,799,830 probably benign Het
Reln A G 5: 21,979,579 I1646T probably benign Het
Rexo1 A T 10: 80,550,261 L321Q probably damaging Het
Rfx3 T A 19: 27,806,325 E382V probably benign Het
Rnf20 C T 4: 49,648,437 T415I possibly damaging Het
Rpl10-ps3 T A 9: 50,344,778 D55V probably benign Het
Sag A G 1: 87,805,330 T7A probably benign Het
Saysd1 G A 14: 20,082,937 R51C probably damaging Het
Shprh T A 10: 11,164,830 Y682* probably null Het
Slc6a13 T C 6: 121,325,053 I198T probably damaging Het
Smyd5 C A 6: 85,438,847 C101* probably null Het
Spata31d1d A G 13: 59,726,607 V1038A probably benign Het
Stat6 T C 10: 127,658,642 S692P probably benign Het
Tbc1d9 A T 8: 83,271,551 M1246L probably benign Het
Tmprss5 T A 9: 49,114,594 probably null Het
Trim12a A T 7: 104,304,325 M193K probably benign Het
Ube2t T A 1: 134,971,920 L102H probably damaging Het
Ubr1 G A 2: 120,866,553 R1623W probably damaging Het
Ush2a T G 1: 188,444,653 M1338R probably damaging Het
Usp36 A T 11: 118,284,999 L112Q probably damaging Het
Vmn1r53 A G 6: 90,223,775 M189T probably benign Het
Vmn1r54 T C 6: 90,269,686 V194A probably benign Het
Vmn2r33 A G 7: 7,551,193 V787A probably damaging Het
Vps26a A G 10: 62,464,679 I236T probably damaging Het
Vwde A T 6: 13,195,997 L343Q probably damaging Het
Zan A G 5: 137,395,620 F4523S unknown Het
Zfand5 T A 19: 21,277,023 V66E probably benign Het
Zfp658 T A 7: 43,573,374 C358S possibly damaging Het
Zfp977 T A 7: 42,582,648 R64W probably damaging Het
Zfp995 C T 17: 21,880,191 S354N probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTACGGCCATGTGTGATG -3'
(R):5'- TCTCTAACTCCTGAAGGGCTAG -3'

Sequencing Primer
(F):5'- ATGTTTTCTCAGGCCTGATGC -3'
(R):5'- CAAATGTTGTGGTTGGCC -3'
Posted On2021-10-11