Incidental Mutation 'R8996:Stk3'
ID 684737
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Name serine/threonine kinase 3
Synonyms mess1, MST, Mst2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8996 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34875496-35178921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34945062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 427 (S427P)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]
AlphaFold Q9JI10
Predicted Effect possibly damaging
Transcript: ENSMUST00000018476
AA Change: S427P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: S427P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067033
AA Change: S357P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: S357P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226555
AA Change: S425P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 G A 8: 129,219,535 P270S possibly damaging Het
Abcb1a A G 5: 8,719,069 I764V probably benign Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Alcam T C 16: 52,305,751 I68V probably benign Het
Atp8b2 A G 3: 89,943,389 L75P probably damaging Het
B3gnt6 T C 7: 98,193,592 N387S probably benign Het
Btn2a2 T C 13: 23,478,661 E373G probably damaging Het
Cfap65 G A 1: 74,902,188 H1831Y probably benign Het
Cftr T A 6: 18,255,946 C564* probably null Het
Chd6 A G 2: 160,981,623 W1276R probably damaging Het
Csmd1 T C 8: 15,921,105 E3070G possibly damaging Het
Cxcr4 A G 1: 128,589,801 I41T possibly damaging Het
Dnhd1 T A 7: 105,674,035 N583K probably damaging Het
Fignl1 G T 11: 11,802,953 P34Q probably damaging Het
Frg2f1 T C 4: 119,530,888 D138G probably damaging Het
Gabra4 A T 5: 71,571,703 M578K possibly damaging Het
Gnb5 T C 9: 75,344,523 V351A probably benign Het
H2-Ob A T 17: 34,243,557 I245F probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igkv4-54 A T 6: 69,631,790 Y48* probably null Het
Kdm7a A C 6: 39,152,852 H463Q probably benign Het
L3mbtl4 A G 17: 68,463,002 T256A probably benign Het
Lhpp A G 7: 132,610,755 D17G probably damaging Het
Mis18bp1 C T 12: 65,133,858 V950I probably benign Het
Mms22l T A 4: 24,598,884 probably null Het
Mrgpra4 T C 7: 47,981,197 T219A probably benign Het
Nptx1 G A 11: 119,547,568 R8C unknown Het
Plcxd1 A G 5: 110,102,578 T262A probably benign Het
Sf1 G A 19: 6,376,411 G221S Het
Shkbp1 A G 7: 27,343,419 V531A possibly damaging Het
Slc12a3 A T 8: 94,329,435 E66D probably benign Het
Slc14a1 A T 18: 78,113,696 I198K possibly damaging Het
Spag8 T C 4: 43,651,998 E362G probably damaging Het
Speer4c T A 5: 15,710,888 I161L probably benign Het
Stt3b T C 9: 115,243,997 K814E unknown Het
Synpo T A 18: 60,604,158 I239F possibly damaging Het
Tcf7l1 G T 6: 72,788,580 R97S possibly damaging Het
Trav15-2-dv6-2 T A 14: 53,649,790 Y56N probably benign Het
Ttc39c A G 18: 12,687,079 N112S probably benign Het
Usp14 T C 18: 10,000,521 K380E probably benign Het
Usp17lb C T 7: 104,841,682 A13T probably benign Het
Usp4 G A 9: 108,391,710 R921H probably damaging Het
Xndc1 A G 7: 102,073,311 D61G probably damaging Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
R7862:Stk3 UTSW 15 35115586 missense possibly damaging 0.90
R8354:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8454:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R9160:Stk3 UTSW 15 35099465 missense probably damaging 0.99
R9366:Stk3 UTSW 15 35072488 missense probably damaging 1.00
R9777:Stk3 UTSW 15 35114645 missense probably damaging 1.00
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTACACATTAATACGCAGTCTG -3'
(R):5'- TGCTTTGGCCAGGATACATC -3'

Sequencing Primer
(F):5'- ACATTAATACGCAGTCTGTAGTTTAC -3'
(R):5'- GGCCAGGATACATCTACTATATGGC -3'
Posted On 2021-10-11