Incidental Mutation 'R8997:Greb1l'
ID 684794
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8997 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10510747 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 614 (T614S)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: T614S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: T614S

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: T505S

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: T505S

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172680
AA Change: T15S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942
AA Change: T15S

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Abhd17a T C 10: 80,586,636 T71A probably benign Het
Adgrv1 GTT GT 13: 81,405,338 probably null Het
Adra2a T C 19: 54,047,298 S362P probably benign Het
Arid1a T A 4: 133,694,032 N436Y unknown Het
Cma2 T A 14: 55,972,744 C85S probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Cntn3 A G 6: 102,204,062 V724A probably damaging Het
Dennd1a C T 2: 37,800,485 G868R probably benign Het
Disp2 C T 2: 118,786,986 P154S probably damaging Het
Dlgap1 A G 17: 70,516,533 D171G possibly damaging Het
Dpp4 A C 2: 62,334,614 I697S probably damaging Het
Dync2h1 A T 9: 7,129,003 D1837E probably benign Het
Fbxo39 T A 11: 72,317,640 S273T probably damaging Het
Fgf5 A T 5: 98,275,552 *265C probably null Het
Fscb A G 12: 64,473,984 V236A possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gtdc1 A T 2: 44,825,374 N52K probably benign Het
Il6ra T C 3: 89,887,111 D181G probably damaging Het
Inhba T G 13: 16,026,522 V223G possibly damaging Het
Kcnma1 T C 14: 23,462,969 probably benign Het
Kdm2b C A 5: 122,880,173 W1068L probably null Het
Mdn1 T C 4: 32,773,275 L5485P probably damaging Het
Muc16 T C 9: 18,607,467 probably benign Het
Ncapd3 T C 9: 27,048,281 F338L probably damaging Het
Negr1 T A 3: 157,016,281 I164N probably damaging Het
Nek9 A T 12: 85,320,791 C369S probably benign Het
Ninl C T 2: 150,959,896 E151K probably damaging Het
Nphp1 A T 2: 127,754,062 S494R possibly damaging Het
Nphp4 G A 4: 152,538,888 R673H probably damaging Het
Obscn C T 11: 59,043,803 probably benign Het
Osbpl8 T C 10: 111,255,714 S82P probably benign Het
Papd5 T A 8: 88,252,395 V508D probably benign Het
Pcdhgb1 C A 18: 37,681,080 P208Q probably damaging Het
Pik3c2b A G 1: 133,090,779 E988G possibly damaging Het
Rfc1 A T 5: 65,275,721 M722K probably damaging Het
Rnf111 A T 9: 70,476,263 N129K probably damaging Het
Sdccag8 C A 1: 176,955,808 L628I probably damaging Het
Sgcz G T 8: 38,660,740 D8E probably benign Het
Sgip1 T A 4: 102,933,584 F254L Het
Shf A G 2: 122,357,247 L26P probably damaging Het
Slc39a5 G A 10: 128,396,479 A484V probably damaging Het
Slco4c1 T A 1: 96,867,947 I129F probably damaging Het
Tbck A T 3: 132,734,345 probably null Het
Teddm3 A T 16: 21,152,937 V294E probably damaging Het
Treml1 A T 17: 48,360,438 H117L probably damaging Het
Trip12 G T 1: 84,793,875 T184N probably benign Het
Tuba3b G T 6: 145,621,228 M398I possibly damaging Het
Vcam1 T C 3: 116,117,328 I474V probably benign Het
Wdsub1 A C 2: 59,858,633 M415R probably damaging Het
Zfp14 A T 7: 30,038,175 F462I probably damaging Het
Zfp846 G A 9: 20,594,430 V529I probably benign Het
Zfp873 A G 10: 82,061,156 T574A probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
R9015:Greb1l UTSW 18 10541675 missense probably benign 0.00
R9018:Greb1l UTSW 18 10542004 missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10532797 missense probably damaging 1.00
R9074:Greb1l UTSW 18 10558795 missense probably damaging 1.00
R9117:Greb1l UTSW 18 10542422 missense probably benign 0.31
R9189:Greb1l UTSW 18 10499983 missense probably benign
R9332:Greb1l UTSW 18 10532796 missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10522130 missense probably benign 0.00
R9497:Greb1l UTSW 18 10458600 missense probably benign 0.00
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATCATTAGTGCTGCAGC -3'
(R):5'- TGAGGCTTTAATCCTGCATCC -3'

Sequencing Primer
(F):5'- CAGCAAGCATTAGTTCCAGTG -3'
(R):5'- GAGGCTTTAATCCTGCATCCTTGTG -3'
Posted On 2021-10-11