Incidental Mutation 'R8998:Prkch'
ID684829
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Nameprotein kinase C, eta
SynonymsPkch
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8998 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location73584796-73778185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73696199 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 209 (V209A)
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
Predicted Effect probably damaging
Transcript: ENSMUST00000021527
AA Change: V209A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: V209A

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221153
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 T C 11: 72,030,257 E245G possibly damaging Het
Armc4 C A 18: 7,211,574 V767L possibly damaging Het
Cd6 A T 19: 10,799,278 C128S probably damaging Het
Cep41 T C 6: 30,666,166 D98G probably benign Het
Cfap52 T C 11: 67,927,311 K525E probably damaging Het
Ddx10 T C 9: 53,229,234 E289G possibly damaging Het
Dnah1 T C 14: 31,296,278 T1428A probably benign Het
Dsg3 T C 18: 20,533,627 L631P probably damaging Het
Dusp19 T A 2: 80,630,927 C187S probably benign Het
Fap T C 2: 62,537,024 H338R probably benign Het
Gabrg1 T A 5: 70,816,035 I59F probably benign Het
Glb1l3 A T 9: 26,853,618 probably null Het
Gm11639 A T 11: 104,749,651 M1072L probably benign Het
Gm11756 G C 4: 73,919,183 N99K probably damaging Het
Igkv8-26 C A 6: 70,193,530 A35E probably benign Het
Ikzf1 A G 11: 11,685,013 probably benign Het
Krt18 A C 15: 102,031,439 E357D probably damaging Het
Lbr C T 1: 181,818,947 G470E probably damaging Het
Map2 A T 1: 66,413,314 K454N possibly damaging Het
Map2k3 T C 11: 60,949,991 V282A Het
Men1 G A 19: 6,339,930 V538I probably benign Het
Mfn1 T A 3: 32,569,534 M621K possibly damaging Het
Mpdz C A 4: 81,284,645 G1838* probably null Het
Mypn A T 10: 63,162,271 L420* probably null Het
Nkx6-1 T C 5: 101,664,216 M7V unknown Het
Notum G A 11: 120,654,381 H451Y probably benign Het
Olfr1367 A G 13: 21,347,818 K297E probably damaging Het
Olfr266 A T 3: 106,821,683 I292N probably damaging Het
Olfr788 A G 10: 129,473,517 N275S probably benign Het
Pabpc4l A C 3: 46,446,348 I287S probably benign Het
Pcdha2 C T 18: 36,940,375 T353M possibly damaging Het
Plekha1 T C 7: 130,908,469 I315T unknown Het
Ppp2r2b C T 18: 42,737,928 A106T probably benign Het
Ptprc A G 1: 138,101,192 C284R probably damaging Het
Ptprf A G 4: 118,226,474 V804A probably benign Het
Rbp3 C T 14: 33,962,403 R1130* probably null Het
Serpina6 C G 12: 103,651,729 R275P probably damaging Het
Six3 T A 17: 85,623,736 H273Q probably benign Het
Stk35 C A 2: 129,810,589 P337T probably damaging Het
Supt5 A G 7: 28,338,423 S2P unknown Het
Tnik A G 3: 28,665,771 Y1264C probably damaging Het
Trim45 A G 3: 100,931,644 T621A unknown Het
Tyrp1 T C 4: 80,844,857 L327P probably damaging Het
Vmn2r69 A C 7: 85,411,099 S426A probably benign Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
wolfcreek UTSW 12 73759710 missense probably damaging 1.00
G1Funyon:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
R8734:Prkch UTSW 12 73585244 missense possibly damaging 0.62
R8766:Prkch UTSW 12 73702538 missense probably benign 0.01
R8999:Prkch UTSW 12 73696199 missense probably damaging 1.00
R9058:Prkch UTSW 12 73775534 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGTGTCAGTAGATGCAGG -3'
(R):5'- GCACTGTTGTGGGTCCTAAG -3'

Sequencing Primer
(F):5'- TGTCAGTAGATGCAGGAAGGATG -3'
(R):5'- TCCTAAGGACTATGGGAGGGCTG -3'
Posted On2021-10-11