Incidental Mutation 'R8999:Stk35'
ID 684847
Institutional Source Beutler Lab
Gene Symbol Stk35
Ensembl Gene ENSMUSG00000037885
Gene Name serine/threonine kinase 35
Synonyms 1700054C12Rik, CLIK1, CLP-36 interacting kinase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8999 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 129800517-129832287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 129810589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 337 (P337T)
Ref Sequence ENSEMBL: ENSMUSP00000126541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]
AlphaFold Q80ZW0
Predicted Effect probably damaging
Transcript: ENSMUST00000165413
AA Change: P337T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: P337T

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 295 2e-6 PFAM
Pfam:Pkinase 207 531 8.6e-51 PFAM
Pfam:Pkinase_Tyr 304 532 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166282
SMART Domains Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 300 5.9e-7 PFAM
Pfam:Pkinase 207 311 1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 T C 11: 72,030,257 E245G possibly damaging Het
Armc4 C A 18: 7,211,574 V767L possibly damaging Het
Cd6 A T 19: 10,799,278 C128S probably damaging Het
Cep41 T C 6: 30,666,166 D98G probably benign Het
Cfap52 T C 11: 67,927,311 K525E probably damaging Het
Ddx10 T C 9: 53,229,234 E289G possibly damaging Het
Dnah1 T C 14: 31,296,278 T1428A probably benign Het
Dsg3 T C 18: 20,533,627 L631P probably damaging Het
Dusp19 T A 2: 80,630,927 C187S probably benign Het
Fap T C 2: 62,537,024 H338R probably benign Het
Fxyd2 T C 9: 45,402,997 probably benign Het
Gabrg1 T A 5: 70,816,035 I59F probably benign Het
Glb1l3 A T 9: 26,853,618 probably null Het
Gm11639 A T 11: 104,749,651 M1072L probably benign Het
Gm11756 G C 4: 73,919,183 N99K probably damaging Het
Gpr27 T C 6: 99,692,815 I46T possibly damaging Het
Igkv8-26 C A 6: 70,193,530 A35E probably benign Het
Ikzf1 A G 11: 11,685,013 probably benign Het
Krt18 A C 15: 102,031,439 E357D probably damaging Het
Lbr C T 1: 181,818,947 G470E probably damaging Het
Map2 A T 1: 66,413,314 K454N possibly damaging Het
Map2k3 T C 11: 60,949,991 V282A Het
Men1 G A 19: 6,339,930 V538I probably benign Het
Mfn1 T A 3: 32,569,534 M621K possibly damaging Het
Mpdz C A 4: 81,284,645 G1838* probably null Het
Mypn A T 10: 63,162,271 L420* probably null Het
Nkx6-1 T C 5: 101,664,216 M7V unknown Het
Notum G A 11: 120,654,381 H451Y probably benign Het
Olfr1367 A G 13: 21,347,818 K297E probably damaging Het
Olfr266 A T 3: 106,821,683 I292N probably damaging Het
Olfr788 A G 10: 129,473,517 N275S probably benign Het
Pabpc4l A C 3: 46,446,348 I287S probably benign Het
Pcdha2 C T 18: 36,940,375 T353M possibly damaging Het
Plekha1 T C 7: 130,908,469 I315T unknown Het
Ppp2r2b C T 18: 42,737,928 A106T probably benign Het
Prkch T C 12: 73,696,199 V209A probably damaging Het
Ptprc A G 1: 138,101,192 C284R probably damaging Het
Ptprf A G 4: 118,226,474 V804A probably benign Het
Rbp3 C T 14: 33,962,403 R1130* probably null Het
Serpina6 C G 12: 103,651,729 R275P probably damaging Het
Six3 T A 17: 85,623,736 H273Q probably benign Het
Supt5 A G 7: 28,338,423 S2P unknown Het
Tnik A G 3: 28,665,771 Y1264C probably damaging Het
Trim45 A G 3: 100,931,644 T621A unknown Het
Tyrp1 T C 4: 80,844,857 L327P probably damaging Het
Vmn2r69 A C 7: 85,411,099 S426A probably benign Het
Other mutations in Stk35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Stk35 APN 2 129801992 missense probably damaging 1.00
IGL02609:Stk35 APN 2 129801801 missense probably damaging 1.00
fingernails UTSW 2 129810935 missense probably damaging 1.00
R2256_Stk35_331 UTSW 2 129810507 nonsense probably null
skinned UTSW 2 129811235 intron probably benign
R0045:Stk35 UTSW 2 129800568 nonsense probably null
R0306:Stk35 UTSW 2 129801763 nonsense probably null
R0784:Stk35 UTSW 2 129810802 nonsense probably null
R1536:Stk35 UTSW 2 129811235 intron probably benign
R2256:Stk35 UTSW 2 129810507 nonsense probably null
R2507:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R2508:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R3848:Stk35 UTSW 2 129800736 missense probably benign 0.13
R3872:Stk35 UTSW 2 129810575 missense possibly damaging 0.82
R4466:Stk35 UTSW 2 129801516 missense probably damaging 0.99
R5144:Stk35 UTSW 2 129810935 missense probably damaging 1.00
R6267:Stk35 UTSW 2 129810888 nonsense probably null
R6296:Stk35 UTSW 2 129810888 nonsense probably null
R6480:Stk35 UTSW 2 129810687 missense possibly damaging 0.95
R6807:Stk35 UTSW 2 129801653 missense probably damaging 0.97
R7203:Stk35 UTSW 2 129801593 missense probably benign
R7476:Stk35 UTSW 2 129810725 missense probably damaging 1.00
R8505:Stk35 UTSW 2 129801729 missense probably damaging 0.99
R8998:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R9224:Stk35 UTSW 2 129810571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGGCATAGACTTTGCTTG -3'
(R):5'- ACAGACCTTGCTCAGTCCAAAG -3'

Sequencing Primer
(F):5'- CAGTTGTGTAGATCCTCATGGCAC -3'
(R):5'- CAAAGTCTGCCACCTTGAGGATG -3'
Posted On 2021-10-11