Incidental Mutation 'R9000:Adamts3'
ID 684903
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 068831-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9000 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89854570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 475 (N475S)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: N475S

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: N475S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: N475S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: N475S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 90% (55/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,353,195 (GRCm39) N749S probably damaging Het
Acsl5 T C 19: 55,283,943 (GRCm39) *684Q probably null Het
Actr5 A T 2: 158,478,610 (GRCm39) T487S probably benign Het
Adam18 T A 8: 25,127,162 (GRCm39) H478L probably benign Het
Adam5 A T 8: 25,294,372 (GRCm39) probably null Het
Akap9 G A 5: 4,105,650 (GRCm39) R2907H probably benign Het
Anapc1 A G 2: 128,476,628 (GRCm39) V1330A probably damaging Het
Arhgef37 A T 18: 61,637,333 (GRCm39) M443K possibly damaging Het
Atp13a1 T A 8: 70,254,725 (GRCm39) H753Q probably damaging Het
C2cd3 A G 7: 100,065,281 (GRCm39) H311R Het
Cdh23 A G 10: 60,140,277 (GRCm39) Y3222H possibly damaging Het
Ces2f A G 8: 105,677,661 (GRCm39) D222G probably benign Het
Cnot9 C T 1: 74,561,544 (GRCm39) R130C probably benign Het
Cntnap2 G A 6: 46,461,139 (GRCm39) probably benign Het
Daam2 A G 17: 49,769,197 (GRCm39) L932P probably damaging Het
Dgki T C 6: 37,074,643 (GRCm39) probably benign Het
Dync1h1 A C 12: 110,606,397 (GRCm39) Q2489P probably benign Het
Elovl2 A G 13: 41,338,810 (GRCm39) L280S probably benign Het
Fat1 C A 8: 45,497,587 (GRCm39) Y4357* probably null Het
Fat3 T A 9: 15,871,816 (GRCm39) Q3525L possibly damaging Het
Fat3 T C 9: 15,918,095 (GRCm39) I1443V probably benign Het
Fzd1 A G 5: 4,806,211 (GRCm39) I457T probably damaging Het
Kcnq5 G T 1: 21,557,483 (GRCm39) F332L probably damaging Het
Meiob A G 17: 25,047,916 (GRCm39) probably benign Het
Mrgprb4 A G 7: 47,848,769 (GRCm39) L53P probably damaging Het
Myt1l G A 12: 29,901,740 (GRCm39) V832I unknown Het
Nckap5l G A 15: 99,321,310 (GRCm39) P1186S probably damaging Het
Ndufa4l2 A T 10: 127,350,898 (GRCm39) R16S probably benign Het
Nrg2 T C 18: 36,151,682 (GRCm39) Y620C probably damaging Het
Or4p4b-ps1 T A 2: 88,454,525 (GRCm39) *293R probably null Het
Or52a24 T C 7: 103,381,672 (GRCm39) S180P probably damaging Het
Pip4k2a T G 2: 18,877,240 (GRCm39) Y165S possibly damaging Het
Plcd4 T A 1: 74,601,024 (GRCm39) C500* probably null Het
Plcl1 C T 1: 55,736,990 (GRCm39) P777L probably damaging Het
Pnliprp2 T C 19: 58,762,555 (GRCm39) Y387H probably benign Het
Prdm15 A T 16: 97,595,470 (GRCm39) D1119E probably benign Het
Prss51 T C 14: 64,332,420 (GRCm39) S36P possibly damaging Het
Prune1 A G 3: 95,162,635 (GRCm39) V346A probably benign Het
Saxo5 T C 8: 3,526,083 (GRCm39) S79P possibly damaging Het
Scn5a T C 9: 119,321,171 (GRCm39) T1464A possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 GGGG GGGGCCCAGCTCAGCCACAGGG 7: 126,066,743 (GRCm39) probably benign Het
Sim1 T G 10: 50,860,316 (GRCm39) I726S probably benign Het
Sim1 T G 10: 50,860,317 (GRCm39) I726M possibly damaging Het
Slc38a4 G A 15: 96,897,475 (GRCm39) P447S possibly damaging Het
Slc5a12 A G 2: 110,454,525 (GRCm39) E362G probably damaging Het
Slc5a8 C A 10: 88,762,089 (GRCm39) N576K probably benign Het
Slc5a8 T A 10: 88,762,090 (GRCm39) Y577N probably benign Het
Snn A G 16: 10,890,322 (GRCm39) E47G probably damaging Het
Snx19 T C 9: 30,375,619 (GRCm39) V207A unknown Het
Srcap G A 7: 127,130,943 (GRCm39) V720I possibly damaging Het
Syn3 T A 10: 85,893,489 (GRCm39) R451S unknown Het
Tdrp A G 8: 14,003,989 (GRCm39) V116A probably benign Het
Tef G A 15: 81,695,773 (GRCm39) M1I probably null Het
Vmn1r232 T C 17: 21,134,111 (GRCm39) K163R probably damaging Het
Wrnip1 A G 13: 32,986,711 (GRCm39) E164G probably damaging Het
Zcchc14 T G 8: 122,336,880 (GRCm39) H178P unknown Het
Zfp37 T G 4: 62,126,651 (GRCm39) K69T unknown Het
Zfp947 A G 17: 22,365,161 (GRCm39) L171P probably benign Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTATGTACCCAAAGTGTCTAC -3'
(R):5'- GTGCTGAACAAACCCCAGAG -3'

Sequencing Primer
(F):5'- AAGTGTCTACTTTAGCTCCATCAAC -3'
(R):5'- GAAGTTGAGCCGAGAGTCCACTC -3'
Posted On 2021-10-11