Mutagenetix > Incidental Mutation

Incidental Mutation 'R9000:Adamts3'

684903

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9000 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89706711 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 475 (N475S)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: N475S

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: N475S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159
AA Change: N475S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: N475S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

90% (55/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,314,036	N749S	probably damaging	Het
Acsl5	T	C	19: 55,295,511	*684Q	probably null	Het
Actr5	A	T	2: 158,636,690	T487S	probably benign	Het
Adam18	T	A	8: 24,637,146	H478L	probably benign	Het
Adam5	A	T	8: 24,804,356		probably null	Het
Akap9	G	A	5: 4,055,650	R2907H	probably benign	Het
Anapc1	A	G	2: 128,634,708	V1330A	probably damaging	Het
Arhgef37	A	T	18: 61,504,262	M443K	possibly damaging	Het
Atp13a1	T	A	8: 69,802,075	H753Q	probably damaging	Het
C2cd3	A	G	7: 100,416,074	H311R		Het
Cdh23	A	G	10: 60,304,498	Y3222H	possibly damaging	Het
Ces2f	A	G	8: 104,951,029	D222G	probably benign	Het
Cnot9	C	T	1: 74,522,385	R130C	probably benign	Het
Cntnap2	G	A	6: 46,484,205		probably benign	Het
Daam2	A	G	17: 49,462,169	L932P	probably damaging	Het
Dgki	T	C	6: 37,097,708		probably benign	Het
Dync1h1	A	C	12: 110,639,963	Q2489P	probably benign	Het
Elovl2	A	G	13: 41,185,334	L280S	probably benign	Het
Fat1	C	A	8: 45,044,550	Y4357*	probably null	Het
Fat3	T	A	9: 15,960,520	Q3525L	possibly damaging	Het
Fat3	T	C	9: 16,006,799	I1443V	probably benign	Het
Fzd1	A	G	5: 4,756,211	I457T	probably damaging	Het
Kcnq5	G	T	1: 21,487,259	F332L	probably damaging	Het
Meiob	A	G	17: 24,828,942		probably benign	Het
Mrgprb4	A	G	7: 48,199,021	L53P	probably damaging	Het
Myt1l	G	A	12: 29,851,741	V832I	unknown	Het
Nckap5l	G	A	15: 99,423,429	P1186S	probably damaging	Het
Ndufa4l2	A	T	10: 127,515,029	R16S	probably benign	Het
Nrg2	T	C	18: 36,018,629	Y620C	probably damaging	Het
Olfr475-ps1	T	A	2: 88,624,181	*293R	probably null	Het
Olfr628	T	C	7: 103,732,465	S180P	probably damaging	Het
Pip4k2a	T	G	2: 18,872,429	Y165S	possibly damaging	Het
Plcd4	T	A	1: 74,561,865	C500*	probably null	Het
Plcl1	C	T	1: 55,697,831	P777L	probably damaging	Het
Pnliprp2	T	C	19: 58,774,123	Y387H	probably benign	Het
Prdm15	A	T	16: 97,794,270	D1119E	probably benign	Het
Prss51	T	C	14: 64,094,971	S36P	possibly damaging	Het
Prune1	A	G	3: 95,255,324	V346A	probably benign	Het
Scn5a	T	C	9: 119,492,105	T1464A	possibly damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sh2b1	GGGG	GGGGCCCAGCTCAGCCACAGGG	7: 126,467,571		probably benign	Het
Sim1	T	G	10: 50,984,220	I726S	probably benign	Het
Sim1	T	G	10: 50,984,221	I726M	possibly damaging	Het
Slc38a4	G	A	15: 96,999,594	P447S	possibly damaging	Het
Slc5a12	A	G	2: 110,624,180	E362G	probably damaging	Het
Slc5a8	C	A	10: 88,926,227	N576K	probably benign	Het
Slc5a8	T	A	10: 88,926,228	Y577N	probably benign	Het
Snn	A	G	16: 11,072,458	E47G	probably damaging	Het
Snx19	T	C	9: 30,464,323	V207A	unknown	Het
Srcap	G	A	7: 127,531,771	V720I	possibly damaging	Het
Syn3	T	A	10: 86,057,625	R451S	unknown	Het
Tdrp	A	G	8: 13,953,989	V116A	probably benign	Het
Tef	G	A	15: 81,811,572	M1I	probably null	Het
Tex45	T	C	8: 3,476,083	S79P	possibly damaging	Het
Vmn1r232	T	C	17: 20,913,849	K163R	probably damaging	Het
Wrnip1	A	G	13: 32,802,728	E164G	probably damaging	Het
Zcchc14	T	G	8: 121,610,141	H178P	unknown	Het
Zfp37	T	G	4: 62,208,414	K69T	unknown	Het
Zfp947	A	G	17: 22,146,180	L171P	probably benign	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGGCTATGTACCCAAAGTGTCTAC -3'
(R):5'- GTGCTGAACAAACCCCAGAG -3'

Sequencing Primer
(F):5'- AAGTGTCTACTTTAGCTCCATCAAC -3'
(R):5'- GAAGTTGAGCCGAGAGTCCACTC -3'

Posted On

2021-10-11