Incidental Mutation 'R9001:Chst5'
ID 684970
Institutional Source Beutler Lab
Gene Symbol Chst5
Ensembl Gene ENSMUSG00000031952
Gene Name carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Synonyms GST-4, I-GlcNAc6ST
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9001 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 111889136-111910447 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111889902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 362 (H362L)
Ref Sequence ENSEMBL: ENSMUSP00000034430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034430]
AlphaFold Q9QUP4
Predicted Effect probably benign
Transcript: ENSMUST00000034430
AA Change: H362L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034430
Gene: ENSMUSG00000031952
AA Change: H362L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Sulfotransfer_1 40 357 1.2e-25 PFAM
Pfam:Sulfotransfer_3 41 294 4.7e-16 PFAM
low complexity region 363 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in thinner corneas that show abnormally close collagen fibrillar packing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,742 R26G probably damaging Het
Aldh1a2 A G 9: 71,285,180 N439S probably damaging Het
Arfgef3 C T 10: 18,646,728 E517K probably benign Het
Arhgap29 A T 3: 121,981,874 I89L probably benign Het
Btbd3 G A 2: 138,280,376 V149I possibly damaging Het
Cmtm2a A G 8: 104,292,744 V71A probably benign Het
Col6a4 T A 9: 106,067,171 I1035F probably benign Het
Csmd2 T C 4: 128,414,286 V1279A Het
Csmd3 A T 15: 47,733,505 V1068E Het
Ddx50 T C 10: 62,639,949 Y331C probably benign Het
Dhx30 A G 9: 110,087,555 Y631H probably damaging Het
Dnah10 G A 5: 124,775,451 G1915S probably damaging Het
Dopey1 A G 9: 86,554,321 *2463W probably null Het
Dst G T 1: 34,174,211 V1395F possibly damaging Het
Dzip1l T C 9: 99,641,854 probably null Het
Eef1akmt3 T C 10: 127,041,363 E11G probably benign Het
Elfn2 A G 15: 78,673,238 F370L probably benign Het
Enam T A 5: 88,489,529 F104Y probably benign Het
Esd A G 14: 74,745,683 E258G probably benign Het
Fam181b G A 7: 93,081,149 A377T unknown Het
Gabrr3 A G 16: 59,461,645 I454M probably benign Het
Ggt5 T A 10: 75,610,158 V462D probably benign Het
Gm11238 A T 4: 73,657,043 R320* probably null Het
Gm3250 T C 10: 77,782,344 S67G unknown Het
Grn A T 11: 102,436,671 Y286F Het
Gulp1 A G 1: 44,788,549 I284V probably benign Het
Ilf2 A G 3: 90,482,801 N140S probably benign Het
Ints4 C A 7: 97,541,069 P925Q possibly damaging Het
Khdc1b A G 1: 21,384,336 N88D possibly damaging Het
Kif15 T G 9: 122,997,790 C798G probably benign Het
Ktn1 T A 14: 47,672,952 V285E probably damaging Het
Lrif1 A G 3: 106,734,544 S59G probably benign Het
Mpdz A G 4: 81,381,762 M333T probably benign Het
Mrm3 A G 11: 76,250,408 D414G probably benign Het
Mtpap A G 18: 4,380,831 N170D probably benign Het
Nelfb C A 2: 25,206,275 R274L probably damaging Het
Olfr681 T G 7: 105,122,240 V261G probably damaging Het
Pkm A G 9: 59,665,343 N44S probably benign Het
Rel T C 11: 23,748,855 D144G probably damaging Het
Scgb2b21 A T 7: 33,519,531 probably benign Het
Serpinb1b T A 13: 33,093,760 D325E probably benign Het
Slco4c1 A G 1: 96,821,231 C654R probably damaging Het
Srgap2 T C 1: 131,364,060 K143R probably damaging Het
Szt2 G A 4: 118,378,332 H2034Y unknown Het
Thbs2 T C 17: 14,668,745 D1164G probably damaging Het
Tnfrsf10b T C 14: 69,777,801 S243P possibly damaging Het
Tnxb T A 17: 34,703,436 S2408T probably benign Het
Topors A T 4: 40,261,696 D529E possibly damaging Het
Trmt5 T C 12: 73,284,869 M138V probably benign Het
Vmn2r81 A G 10: 79,268,270 I242M possibly damaging Het
Zfp523 A G 17: 28,189,941 Q21R possibly damaging Het
Zfp646 T A 7: 127,879,684 N344K probably damaging Het
Other mutations in Chst5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Chst5 APN 8 111890682 missense probably damaging 1.00
IGL02336:Chst5 APN 8 111890317 missense probably damaging 0.99
IGL02634:Chst5 APN 8 111890845 missense probably damaging 1.00
R0606:Chst5 UTSW 8 111890919 missense probably benign 0.05
R1552:Chst5 UTSW 8 111890280 missense probably damaging 0.99
R2094:Chst5 UTSW 8 111890544 missense probably benign 0.01
R3769:Chst5 UTSW 8 111889881 missense possibly damaging 0.67
R4135:Chst5 UTSW 8 111890184 missense probably damaging 1.00
R4872:Chst5 UTSW 8 111890560 missense possibly damaging 0.61
R5658:Chst5 UTSW 8 111890790 missense probably damaging 1.00
R5759:Chst5 UTSW 8 111890210 missense probably benign 0.25
R5893:Chst5 UTSW 8 111890196 missense probably damaging 1.00
R6657:Chst5 UTSW 8 111890274 missense probably benign 0.00
R6731:Chst5 UTSW 8 111890044 missense probably benign 0.00
R7406:Chst5 UTSW 8 111890613 missense probably benign 0.00
R7535:Chst5 UTSW 8 111890163 missense probably damaging 1.00
R7727:Chst5 UTSW 8 111890925 missense probably benign 0.25
R7835:Chst5 UTSW 8 111890602 missense probably damaging 1.00
R7843:Chst5 UTSW 8 111890572 missense probably benign 0.00
R8257:Chst5 UTSW 8 111890460 missense probably damaging 1.00
R8324:Chst5 UTSW 8 111890508 missense probably benign 0.06
R8444:Chst5 UTSW 8 111890763 missense probably damaging 1.00
R8458:Chst5 UTSW 8 111890790 missense probably damaging 1.00
R9223:Chst5 UTSW 8 111890860 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGACTCCATCCTTTCCTAGTACAG -3'
(R):5'- ATATCACGCATGGTTCAGGGC -3'

Sequencing Primer
(F):5'- GCTACTTGCTTTTGGGTTCTCCAAG -3'
(R):5'- ATGGTTCAGGGCCAGGC -3'
Posted On 2021-10-11