Incidental Mutation 'R9001:Gabrr3'
ID 684995
Institutional Source Beutler Lab
Gene Symbol Gabrr3
Ensembl Gene ENSMUSG00000074991
Gene Name gamma-aminobutyric acid type A receptor subunit rho 3
Synonyms
MMRRC Submission 068832-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R9001 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 59227745-59282102 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59282008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 454 (I454M)
Ref Sequence ENSEMBL: ENSMUSP00000109980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114341]
AlphaFold B2RXA8
Predicted Effect probably benign
Transcript: ENSMUST00000114341
AA Change: I454M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109980
Gene: ENSMUSG00000074991
AA Change: I454M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 264 3.8e-55 PFAM
Pfam:Neur_chan_memb 271 426 8.6e-31 PFAM
transmembrane domain 446 463 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter gamma-aminobutyric acid (GABA) functions in the central nervous system to regulate synaptic transmission of neurons. This gene encodes one of three related subunits, which combine as homo- or hetero-pentamers to form GABA(C) receptors. In humans, some individuals contain a single-base polymorphism (dbSNP rs832032) that is predicted to inactivate the gene product. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,637,176 (GRCm39) R26G probably damaging Het
Aldh1a2 A G 9: 71,192,462 (GRCm39) N439S probably damaging Het
Arfgef3 C T 10: 18,522,476 (GRCm39) E517K probably benign Het
Arhgap29 A T 3: 121,775,523 (GRCm39) I89L probably benign Het
Btbd3 G A 2: 138,122,296 (GRCm39) V149I possibly damaging Het
Chst5 T A 8: 112,616,534 (GRCm39) H362L probably benign Het
Cmtm2a A G 8: 105,019,376 (GRCm39) V71A probably benign Het
Col6a4 T A 9: 105,944,370 (GRCm39) I1035F probably benign Het
Csmd2 T C 4: 128,308,079 (GRCm39) V1279A Het
Csmd3 A T 15: 47,596,901 (GRCm39) V1068E Het
Ddx50 T C 10: 62,475,728 (GRCm39) Y331C probably benign Het
Dhx30 A G 9: 109,916,623 (GRCm39) Y631H probably damaging Het
Dnah10 G A 5: 124,852,515 (GRCm39) G1915S probably damaging Het
Dop1a A G 9: 86,436,374 (GRCm39) *2463W probably null Het
Dst G T 1: 34,213,292 (GRCm39) V1395F possibly damaging Het
Dzip1l T C 9: 99,523,907 (GRCm39) probably null Het
Eef1akmt3 T C 10: 126,877,232 (GRCm39) E11G probably benign Het
Elfn2 A G 15: 78,557,438 (GRCm39) F370L probably benign Het
Enam T A 5: 88,637,388 (GRCm39) F104Y probably benign Het
Esd A G 14: 74,983,123 (GRCm39) E258G probably benign Het
Fam181b G A 7: 92,730,356 (GRCm39) A377T unknown Het
Ggt5 T A 10: 75,445,992 (GRCm39) V462D probably benign Het
Gm3250 T C 10: 77,618,178 (GRCm39) S67G unknown Het
Grn A T 11: 102,327,497 (GRCm39) Y286F Het
Gulp1 A G 1: 44,827,709 (GRCm39) I284V probably benign Het
Ilf2 A G 3: 90,390,108 (GRCm39) N140S probably benign Het
Ints4 C A 7: 97,190,276 (GRCm39) P925Q possibly damaging Het
Khdc1b A G 1: 21,454,560 (GRCm39) N88D possibly damaging Het
Kif15 T G 9: 122,826,855 (GRCm39) C798G probably benign Het
Ktn1 T A 14: 47,910,409 (GRCm39) V285E probably damaging Het
Lrif1 A G 3: 106,641,860 (GRCm39) S59G probably benign Het
Mpdz A G 4: 81,299,999 (GRCm39) M333T probably benign Het
Mrm3 A G 11: 76,141,234 (GRCm39) D414G probably benign Het
Msantd5f3 A T 4: 73,575,280 (GRCm39) R320* probably null Het
Mtpap A G 18: 4,380,831 (GRCm39) N170D probably benign Het
Nelfb C A 2: 25,096,287 (GRCm39) R274L probably damaging Het
Or56a3b T G 7: 104,771,447 (GRCm39) V261G probably damaging Het
Pkm A G 9: 59,572,626 (GRCm39) N44S probably benign Het
Rel T C 11: 23,698,855 (GRCm39) D144G probably damaging Het
Scgb2b21 A T 7: 33,218,956 (GRCm39) probably benign Het
Serpinb1b T A 13: 33,277,743 (GRCm39) D325E probably benign Het
Slco4c1 A G 1: 96,748,956 (GRCm39) C654R probably damaging Het
Srgap2 T C 1: 131,291,798 (GRCm39) K143R probably damaging Het
Szt2 G A 4: 118,235,529 (GRCm39) H2034Y unknown Het
Thbs2 T C 17: 14,889,007 (GRCm39) D1164G probably damaging Het
Tnfrsf10b T C 14: 70,015,250 (GRCm39) S243P possibly damaging Het
Tnxb T A 17: 34,922,410 (GRCm39) S2408T probably benign Het
Topors A T 4: 40,261,696 (GRCm39) D529E possibly damaging Het
Trmt5 T C 12: 73,331,643 (GRCm39) M138V probably benign Het
Vmn2r81 A G 10: 79,104,104 (GRCm39) I242M possibly damaging Het
Zfp523 A G 17: 28,408,915 (GRCm39) Q21R possibly damaging Het
Zfp646 T A 7: 127,478,856 (GRCm39) N344K probably damaging Het
Other mutations in Gabrr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02816:Gabrr3 APN 16 59,260,830 (GRCm39) splice site probably benign
IGL02989:Gabrr3 APN 16 59,268,371 (GRCm39) missense probably damaging 0.98
IGL03048:Gabrr3 UTSW 16 59,250,493 (GRCm39) missense probably benign 0.00
PIT4791001:Gabrr3 UTSW 16 59,250,298 (GRCm39) critical splice acceptor site probably null
R0368:Gabrr3 UTSW 16 59,260,959 (GRCm39) missense probably damaging 0.99
R0976:Gabrr3 UTSW 16 59,281,887 (GRCm39) missense probably benign 0.34
R1104:Gabrr3 UTSW 16 59,281,998 (GRCm39) missense probably damaging 0.98
R1231:Gabrr3 UTSW 16 59,281,763 (GRCm39) missense probably benign 0.01
R1556:Gabrr3 UTSW 16 59,281,763 (GRCm39) missense probably benign 0.01
R2181:Gabrr3 UTSW 16 59,268,372 (GRCm39) missense probably damaging 0.98
R2185:Gabrr3 UTSW 16 59,255,031 (GRCm39) missense probably damaging 1.00
R2336:Gabrr3 UTSW 16 59,250,313 (GRCm39) missense probably damaging 1.00
R3941:Gabrr3 UTSW 16 59,253,864 (GRCm39) missense probably damaging 1.00
R4572:Gabrr3 UTSW 16 59,282,001 (GRCm39) missense probably benign 0.09
R4747:Gabrr3 UTSW 16 59,268,277 (GRCm39) splice site probably null
R4786:Gabrr3 UTSW 16 59,250,463 (GRCm39) missense probably benign 0.44
R4845:Gabrr3 UTSW 16 59,246,833 (GRCm39) missense probably damaging 0.99
R5539:Gabrr3 UTSW 16 59,281,758 (GRCm39) missense probably benign
R5543:Gabrr3 UTSW 16 59,253,870 (GRCm39) missense probably damaging 1.00
R5979:Gabrr3 UTSW 16 59,254,931 (GRCm39) missense possibly damaging 0.81
R6211:Gabrr3 UTSW 16 59,268,471 (GRCm39) missense probably benign
R7338:Gabrr3 UTSW 16 59,268,439 (GRCm39) missense possibly damaging 0.70
R7456:Gabrr3 UTSW 16 59,227,853 (GRCm39) nonsense probably null
R8673:Gabrr3 UTSW 16 59,235,633 (GRCm39) missense possibly damaging 0.55
R9139:Gabrr3 UTSW 16 59,227,830 (GRCm39) missense probably benign 0.12
R9378:Gabrr3 UTSW 16 59,282,037 (GRCm39) missense possibly damaging 0.78
Z1176:Gabrr3 UTSW 16 59,227,845 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCTACACTCAGAAGAGGACTCC -3'
(R):5'- AGACATGACTGGCTCTATCCC -3'

Sequencing Primer
(F):5'- TCCATGAGTACAAAGTTCACAGG -3'
(R):5'- TTAACTGTCCAACTCATATCCAGGG -3'
Posted On 2021-10-11