Incidental Mutation 'R9001:Gabrr3'
ID 684995
Institutional Source Beutler Lab
Gene Symbol Gabrr3
Ensembl Gene ENSMUSG00000074991
Gene Name gamma-aminobutyric acid (GABA) receptor, rho 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R9001 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 59407332-59464504 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59461645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 454 (I454M)
Ref Sequence ENSEMBL: ENSMUSP00000109980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114341]
AlphaFold B2RXA8
Predicted Effect probably benign
Transcript: ENSMUST00000114341
AA Change: I454M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109980
Gene: ENSMUSG00000074991
AA Change: I454M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 264 3.8e-55 PFAM
Pfam:Neur_chan_memb 271 426 8.6e-31 PFAM
transmembrane domain 446 463 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter gamma-aminobutyric acid (GABA) functions in the central nervous system to regulate synaptic transmission of neurons. This gene encodes one of three related subunits, which combine as homo- or hetero-pentamers to form GABA(C) receptors. In humans, some individuals contain a single-base polymorphism (dbSNP rs832032) that is predicted to inactivate the gene product. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,742 R26G probably damaging Het
Aldh1a2 A G 9: 71,285,180 N439S probably damaging Het
Arfgef3 C T 10: 18,646,728 E517K probably benign Het
Arhgap29 A T 3: 121,981,874 I89L probably benign Het
Btbd3 G A 2: 138,280,376 V149I possibly damaging Het
Chst5 T A 8: 111,889,902 H362L probably benign Het
Cmtm2a A G 8: 104,292,744 V71A probably benign Het
Col6a4 T A 9: 106,067,171 I1035F probably benign Het
Csmd2 T C 4: 128,414,286 V1279A Het
Csmd3 A T 15: 47,733,505 V1068E Het
Ddx50 T C 10: 62,639,949 Y331C probably benign Het
Dhx30 A G 9: 110,087,555 Y631H probably damaging Het
Dnah10 G A 5: 124,775,451 G1915S probably damaging Het
Dopey1 A G 9: 86,554,321 *2463W probably null Het
Dst G T 1: 34,174,211 V1395F possibly damaging Het
Dzip1l T C 9: 99,641,854 probably null Het
Eef1akmt3 T C 10: 127,041,363 E11G probably benign Het
Elfn2 A G 15: 78,673,238 F370L probably benign Het
Enam T A 5: 88,489,529 F104Y probably benign Het
Esd A G 14: 74,745,683 E258G probably benign Het
Fam181b G A 7: 93,081,149 A377T unknown Het
Ggt5 T A 10: 75,610,158 V462D probably benign Het
Gm11238 A T 4: 73,657,043 R320* probably null Het
Gm3250 T C 10: 77,782,344 S67G unknown Het
Grn A T 11: 102,436,671 Y286F Het
Gulp1 A G 1: 44,788,549 I284V probably benign Het
Ilf2 A G 3: 90,482,801 N140S probably benign Het
Ints4 C A 7: 97,541,069 P925Q possibly damaging Het
Khdc1b A G 1: 21,384,336 N88D possibly damaging Het
Kif15 T G 9: 122,997,790 C798G probably benign Het
Ktn1 T A 14: 47,672,952 V285E probably damaging Het
Lrif1 A G 3: 106,734,544 S59G probably benign Het
Mpdz A G 4: 81,381,762 M333T probably benign Het
Mrm3 A G 11: 76,250,408 D414G probably benign Het
Mtpap A G 18: 4,380,831 N170D probably benign Het
Nelfb C A 2: 25,206,275 R274L probably damaging Het
Olfr681 T G 7: 105,122,240 V261G probably damaging Het
Pkm A G 9: 59,665,343 N44S probably benign Het
Rel T C 11: 23,748,855 D144G probably damaging Het
Scgb2b21 A T 7: 33,519,531 probably benign Het
Serpinb1b T A 13: 33,093,760 D325E probably benign Het
Slco4c1 A G 1: 96,821,231 C654R probably damaging Het
Srgap2 T C 1: 131,364,060 K143R probably damaging Het
Szt2 G A 4: 118,378,332 H2034Y unknown Het
Thbs2 T C 17: 14,668,745 D1164G probably damaging Het
Tnfrsf10b T C 14: 69,777,801 S243P possibly damaging Het
Tnxb T A 17: 34,703,436 S2408T probably benign Het
Topors A T 4: 40,261,696 D529E possibly damaging Het
Trmt5 T C 12: 73,284,869 M138V probably benign Het
Vmn2r81 A G 10: 79,268,270 I242M possibly damaging Het
Zfp523 A G 17: 28,189,941 Q21R possibly damaging Het
Zfp646 T A 7: 127,879,684 N344K probably damaging Het
Other mutations in Gabrr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02816:Gabrr3 APN 16 59440467 splice site probably benign
IGL02989:Gabrr3 APN 16 59448008 missense probably damaging 0.98
IGL03048:Gabrr3 UTSW 16 59430130 missense probably benign 0.00
PIT4791001:Gabrr3 UTSW 16 59429935 critical splice acceptor site probably null
R0368:Gabrr3 UTSW 16 59440596 missense probably damaging 0.99
R0976:Gabrr3 UTSW 16 59461524 missense probably benign 0.34
R1104:Gabrr3 UTSW 16 59461635 missense probably damaging 0.98
R1231:Gabrr3 UTSW 16 59461400 missense probably benign 0.01
R1556:Gabrr3 UTSW 16 59461400 missense probably benign 0.01
R2181:Gabrr3 UTSW 16 59448009 missense probably damaging 0.98
R2185:Gabrr3 UTSW 16 59434668 missense probably damaging 1.00
R2336:Gabrr3 UTSW 16 59429950 missense probably damaging 1.00
R3941:Gabrr3 UTSW 16 59433501 missense probably damaging 1.00
R4572:Gabrr3 UTSW 16 59461638 missense probably benign 0.09
R4747:Gabrr3 UTSW 16 59447914 splice site probably null
R4786:Gabrr3 UTSW 16 59430100 missense probably benign 0.44
R4845:Gabrr3 UTSW 16 59426470 missense probably damaging 0.99
R5539:Gabrr3 UTSW 16 59461395 missense probably benign
R5543:Gabrr3 UTSW 16 59433507 missense probably damaging 1.00
R5979:Gabrr3 UTSW 16 59434568 missense possibly damaging 0.81
R6211:Gabrr3 UTSW 16 59448108 missense probably benign
R7338:Gabrr3 UTSW 16 59448076 missense possibly damaging 0.70
R7456:Gabrr3 UTSW 16 59407490 nonsense probably null
R8673:Gabrr3 UTSW 16 59415270 missense possibly damaging 0.55
R9139:Gabrr3 UTSW 16 59407467 missense probably benign 0.12
R9378:Gabrr3 UTSW 16 59461674 missense possibly damaging 0.78
Z1176:Gabrr3 UTSW 16 59407482 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCTACACTCAGAAGAGGACTCC -3'
(R):5'- AGACATGACTGGCTCTATCCC -3'

Sequencing Primer
(F):5'- TCCATGAGTACAAAGTTCACAGG -3'
(R):5'- TTAACTGTCCAACTCATATCCAGGG -3'
Posted On 2021-10-11