Incidental Mutation 'R9002:Col4a4'
ID 685000
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Name collagen, type IV, alpha 4
Synonyms E130010M05Rik, [a]4(IV)
Accession Numbers

Genbank: NM_007735; MGI: 104687
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 82448423-82586849 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82471311 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1186 (L1186P)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
AlphaFold Q9QZR9
Predicted Effect probably benign
Transcript: ENSMUST00000087050
AA Change: L1186P

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: L1186P

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,926 M1263K possibly damaging Het
Abca8b C T 11: 109,952,630 D985N probably benign Het
Ak5 A T 3: 152,653,454 M207K probably damaging Het
Akt1 T C 12: 112,659,614 I75V probably benign Het
Ank T A 15: 27,544,327 L58* probably null Het
Ap1g1 A C 8: 109,855,106 T666P probably benign Het
Ap3b2 A T 7: 81,467,444 S615T probably benign Het
Ash1l G T 3: 88,981,408 R198L probably benign Het
Axl A T 7: 25,778,678 C199S probably damaging Het
C1d T C 11: 17,262,787 L44S probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Ctdsp2 T A 10: 126,996,192 I223N probably damaging Het
Eml1 T A 12: 108,538,179 I799N probably damaging Het
Fbxw18 G A 9: 109,690,592 T282I probably damaging Het
Fmo2 A T 1: 162,878,078 C397* probably null Het
Gbp10 C A 5: 105,221,981 V262L probably benign Het
Gm11639 A T 11: 105,029,996 D4671V probably damaging Het
Gm45871 A T 18: 90,591,844 H402L probably damaging Het
Has1 T C 17: 17,843,650 S576G unknown Het
Hat1 C T 2: 71,441,303 R407W probably damaging Het
Hivep2 G T 10: 14,132,413 R1585L probably benign Het
Ifi211 A G 1: 173,906,328 V89A possibly damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Irf9 T A 14: 55,607,683 N333K possibly damaging Het
Jakmip2 C T 18: 43,582,258 V68I probably benign Het
Kif1b T G 4: 149,191,255 I1400L probably damaging Het
Kif2b C T 11: 91,576,227 C410Y probably benign Het
Klk1b16 T C 7: 44,140,765 L153P possibly damaging Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lama5 A G 2: 180,196,518 C855R probably damaging Het
Mast3 A G 8: 70,781,260 L947P probably damaging Het
Mblac2 C A 13: 81,711,953 A142E possibly damaging Het
Mppe1 A G 18: 67,225,854 S348P possibly damaging Het
Mroh8 A C 2: 157,217,019 V909G probably damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nek10 T C 14: 14,980,590 L982P probably damaging Het
Nlrp4b C T 7: 10,714,959 T363I probably damaging Het
Nol10 A G 12: 17,358,133 E120G probably damaging Het
Olfml1 T C 7: 107,590,216 S163P probably damaging Het
Olfr1104 T C 2: 87,021,897 T216A probably benign Het
Olfr135 A T 17: 38,208,664 N140Y probably benign Het
Olfr522 T C 7: 140,162,285 I222V probably damaging Het
Olfr576 A T 7: 102,965,411 I104F probably damaging Het
Olfr902 T A 9: 38,448,875 M1K probably null Het
Pde6a T A 18: 61,285,989 L812Q probably damaging Het
Pdxp T A 15: 78,918,259 M231K probably damaging Het
Pi4ka A G 16: 17,299,453 L1368P Het
Ppie T C 4: 123,130,551 N171S possibly damaging Het
Rimbp2 T C 5: 128,788,292 H657R probably benign Het
Sarnp T A 10: 128,821,973 probably null Het
Serpinb9c T C 13: 33,150,346 T266A probably damaging Het
Srgap3 T A 6: 112,780,893 I218F possibly damaging Het
Susd1 C A 4: 59,324,882 W717L probably benign Het
Tgfbi A G 13: 56,623,589 Y88C probably damaging Het
Tmc6 A T 11: 117,770,482 F624Y probably damaging Het
Tnni2 A G 7: 142,444,276 E172G probably damaging Het
Traf3ip1 T C 1: 91,505,456 S316P probably benign Het
Tshr C A 12: 91,537,774 N495K possibly damaging Het
Ulk3 C A 9: 57,593,259 A317E probably damaging Het
Usp24 T C 4: 106,418,215 V2229A possibly damaging Het
Usp32 G A 11: 85,053,951 R304C probably damaging Het
Usp40 C T 1: 88,007,341 G28D probably benign Het
Vmn1r41 A G 6: 89,747,127 K217E possibly damaging Het
Vmn2r73 T A 7: 85,858,076 K676M probably benign Het
Vnn1 A G 10: 23,899,451 T200A possibly damaging Het
Zc3hav1 A G 6: 38,325,241 L698P possibly damaging Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
amazement UTSW 1 82480486 nonsense probably null
aoba UTSW 1 82535740 critical splice donor site probably benign
asombro UTSW 1 82489009 critical splice donor site probably null
astonishment UTSW 1 82455728 missense unknown
wonderment UTSW 1 82453144 missense unknown
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0083:Col4a4 UTSW 1 82507111 critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1508:Col4a4 UTSW 1 82455836 missense unknown
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 splice site probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4757:Col4a4 UTSW 1 82528466 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5264:Col4a4 UTSW 1 82493591 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6192:Col4a4 UTSW 1 82484430 missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
R7000:Col4a4 UTSW 1 82497330 missense unknown
R7015:Col4a4 UTSW 1 82506950 missense unknown
R7055:Col4a4 UTSW 1 82519036 missense unknown
R7288:Col4a4 UTSW 1 82492463 missense unknown
R7293:Col4a4 UTSW 1 82523943 missense unknown
R7300:Col4a4 UTSW 1 82486640 missense unknown
R7458:Col4a4 UTSW 1 82498948 missense unknown
R7520:Col4a4 UTSW 1 82507087 nonsense probably null
R7727:Col4a4 UTSW 1 82528793 missense unknown
R7803:Col4a4 UTSW 1 82489698 critical splice donor site probably null
R7953:Col4a4 UTSW 1 82453968 missense unknown
R7959:Col4a4 UTSW 1 82507059 missense unknown
R7982:Col4a4 UTSW 1 82571441 start gained probably benign
R8000:Col4a4 UTSW 1 82541297 missense unknown
R8057:Col4a4 UTSW 1 82523870 missense unknown
R8126:Col4a4 UTSW 1 82453286 missense unknown
R8406:Col4a4 UTSW 1 82523890 missense unknown
R8699:Col4a4 UTSW 1 82455734 missense unknown
R8835:Col4a4 UTSW 1 82469592 missense unknown
R8916:Col4a4 UTSW 1 82523946 missense unknown
R8921:Col4a4 UTSW 1 82453812 missense unknown
R8990:Col4a4 UTSW 1 82495834 missense unknown
R9116:Col4a4 UTSW 1 82454031 missense unknown
R9176:Col4a4 UTSW 1 82485628 missense unknown
R9211:Col4a4 UTSW 1 82528780 missense unknown
R9246:Col4a4 UTSW 1 82453235 missense unknown
R9463:Col4a4 UTSW 1 82453355 missense unknown
R9666:Col4a4 UTSW 1 82518949 missense unknown
R9686:Col4a4 UTSW 1 82497241 missense unknown
R9705:Col4a4 UTSW 1 82487592 missense unknown
R9749:Col4a4 UTSW 1 82485632 missense unknown
R9774:Col4a4 UTSW 1 82506944 critical splice donor site probably null
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- TATGTTAGCCCCGCCACATC -3'
(R):5'- GAAACTGCCCCTAAACTAACGTTTC -3'

Sequencing Primer
(F):5'- GTTAGCCCCGCCACATCTAAAATG -3'
(R):5'- GCCCCTAAACTAACGTTTCTTAAAAG -3'
Posted On 2021-10-11