Incidental Mutation 'R9002:Hat1'
ID 685005
Institutional Source Beutler Lab
Gene Symbol Hat1
Ensembl Gene ENSMUSG00000027018
Gene Name histone aminotransferase 1
Synonyms KAT1, 2410071B14Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 71219604-71271966 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71271647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 407 (R407W)
Ref Sequence ENSEMBL: ENSMUSP00000028408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028408] [ENSMUST00000112122]
AlphaFold Q8BY71
Predicted Effect probably damaging
Transcript: ENSMUST00000028408
AA Change: R407W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028408
Gene: ENSMUSG00000027018
AA Change: R407W

DomainStartEndE-ValueType
Pfam:Hat1_N 23 184 1.3e-49 PFAM
coiled coil region 386 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112122
AA Change: R414W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107750
Gene: ENSMUSG00000027018
AA Change: R414W

DomainStartEndE-ValueType
Pfam:Hat1_N 22 184 4.4e-49 PFAM
coiled coil region 393 423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal, perinatal and neonatal lethality with impaired lung maturation, atelectasis, respiratory failure, craniofacial defects and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,241,926 (GRCm39) M1263K possibly damaging Het
Abca8b C T 11: 109,843,456 (GRCm39) D985N probably benign Het
Ak5 A T 3: 152,359,091 (GRCm39) M207K probably damaging Het
Akt1 T C 12: 112,626,048 (GRCm39) I75V probably benign Het
Ank T A 15: 27,544,413 (GRCm39) L58* probably null Het
Ap1g1 A C 8: 110,581,738 (GRCm39) T666P probably benign Het
Ap3b2 A T 7: 81,117,192 (GRCm39) S615T probably benign Het
Ash1l G T 3: 88,888,715 (GRCm39) R198L probably benign Het
Axl A T 7: 25,478,103 (GRCm39) C199S probably damaging Het
C1d T C 11: 17,212,787 (GRCm39) L44S probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Col4a4 A G 1: 82,449,032 (GRCm39) L1186P probably benign Het
Ctdsp2 T A 10: 126,832,061 (GRCm39) I223N probably damaging Het
Efcab3 A T 11: 104,920,822 (GRCm39) D4671V probably damaging Het
Eml1 T A 12: 108,504,438 (GRCm39) I799N probably damaging Het
Fbxw18 G A 9: 109,519,660 (GRCm39) T282I probably damaging Het
Fmo2 A T 1: 162,705,647 (GRCm39) C397* probably null Het
Gbp10 C A 5: 105,369,847 (GRCm39) V262L probably benign Het
Gm45871 A T 18: 90,609,968 (GRCm39) H402L probably damaging Het
Has1 T C 17: 18,063,912 (GRCm39) S576G unknown Het
Hivep2 G T 10: 14,008,157 (GRCm39) R1585L probably benign Het
Ifi211 A G 1: 173,733,894 (GRCm39) V89A possibly damaging Het
Igkv4-59 T C 6: 69,415,475 (GRCm39) T27A possibly damaging Het
Irf9 T A 14: 55,845,140 (GRCm39) N333K possibly damaging Het
Jakmip2 C T 18: 43,715,323 (GRCm39) V68I probably benign Het
Kif1b T G 4: 149,275,712 (GRCm39) I1400L probably damaging Het
Kif2b C T 11: 91,467,053 (GRCm39) C410Y probably benign Het
Klk1b16 T C 7: 43,790,189 (GRCm39) L153P possibly damaging Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lama5 A G 2: 179,838,311 (GRCm39) C855R probably damaging Het
Mast3 A G 8: 71,233,904 (GRCm39) L947P probably damaging Het
Mblac2 C A 13: 81,860,072 (GRCm39) A142E possibly damaging Het
Mppe1 A G 18: 67,358,925 (GRCm39) S348P possibly damaging Het
Mroh8 A C 2: 157,058,939 (GRCm39) V909G probably damaging Het
Mthfd1 C T 12: 76,350,754 (GRCm39) T712M probably benign Het
Nek10 T C 14: 14,980,590 (GRCm38) L982P probably damaging Het
Nlrp4b C T 7: 10,448,886 (GRCm39) T363I probably damaging Het
Nol10 A G 12: 17,408,134 (GRCm39) E120G probably damaging Het
Olfml1 T C 7: 107,189,423 (GRCm39) S163P probably damaging Het
Or2n1c A T 17: 38,519,555 (GRCm39) N140Y probably benign Het
Or51a7 A T 7: 102,614,618 (GRCm39) I104F probably damaging Het
Or6ae1 T C 7: 139,742,198 (GRCm39) I222V probably damaging Het
Or8b43 T A 9: 38,360,171 (GRCm39) M1K probably null Het
Or8i2 T C 2: 86,852,241 (GRCm39) T216A probably benign Het
Pde6a T A 18: 61,419,060 (GRCm39) L812Q probably damaging Het
Pdxp T A 15: 78,802,459 (GRCm39) M231K probably damaging Het
Pi4ka A G 16: 17,117,317 (GRCm39) L1368P Het
Ppie T C 4: 123,024,344 (GRCm39) N171S possibly damaging Het
Rimbp2 T C 5: 128,865,356 (GRCm39) H657R probably benign Het
Sarnp T A 10: 128,657,842 (GRCm39) probably null Het
Serpinb9c T C 13: 33,334,329 (GRCm39) T266A probably damaging Het
Srgap3 T A 6: 112,757,854 (GRCm39) I218F possibly damaging Het
Susd1 C A 4: 59,324,882 (GRCm39) W717L probably benign Het
Tgfbi A G 13: 56,771,402 (GRCm39) Y88C probably damaging Het
Tmc6 A T 11: 117,661,308 (GRCm39) F624Y probably damaging Het
Tnni2 A G 7: 141,998,013 (GRCm39) E172G probably damaging Het
Traf3ip1 T C 1: 91,433,178 (GRCm39) S316P probably benign Het
Tshr C A 12: 91,504,548 (GRCm39) N495K possibly damaging Het
Ulk3 C A 9: 57,500,542 (GRCm39) A317E probably damaging Het
Usp24 T C 4: 106,275,412 (GRCm39) V2229A possibly damaging Het
Usp32 G A 11: 84,944,777 (GRCm39) R304C probably damaging Het
Usp40 C T 1: 87,935,063 (GRCm39) G28D probably benign Het
Vmn1r41 A G 6: 89,724,109 (GRCm39) K217E possibly damaging Het
Vmn2r73 T A 7: 85,507,284 (GRCm39) K676M probably benign Het
Vnn1 A G 10: 23,775,349 (GRCm39) T200A possibly damaging Het
Zc3hav1 A G 6: 38,302,176 (GRCm39) L698P possibly damaging Het
Other mutations in Hat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Hat1 APN 2 71,251,604 (GRCm39) missense probably damaging 1.00
IGL02945:Hat1 APN 2 71,251,037 (GRCm39) missense probably benign 0.01
IGL02796:Hat1 UTSW 2 71,250,700 (GRCm39) critical splice donor site probably null
R0789:Hat1 UTSW 2 71,252,088 (GRCm39) splice site probably benign
R0907:Hat1 UTSW 2 71,250,961 (GRCm39) nonsense probably null
R1412:Hat1 UTSW 2 71,250,961 (GRCm39) nonsense probably null
R1571:Hat1 UTSW 2 71,264,519 (GRCm39) missense probably benign
R1868:Hat1 UTSW 2 71,251,627 (GRCm39) nonsense probably null
R1981:Hat1 UTSW 2 71,220,321 (GRCm39) missense probably benign 0.01
R2064:Hat1 UTSW 2 71,240,504 (GRCm39) missense possibly damaging 0.71
R2089:Hat1 UTSW 2 71,264,378 (GRCm39) missense probably benign 0.12
R2091:Hat1 UTSW 2 71,264,378 (GRCm39) missense probably benign 0.12
R2091:Hat1 UTSW 2 71,264,378 (GRCm39) missense probably benign 0.12
R4115:Hat1 UTSW 2 71,271,566 (GRCm39) missense probably benign 0.01
R5579:Hat1 UTSW 2 71,240,582 (GRCm39) missense possibly damaging 0.86
R5650:Hat1 UTSW 2 71,264,378 (GRCm39) missense probably benign 0.12
R5681:Hat1 UTSW 2 71,264,553 (GRCm39) splice site probably null
R5895:Hat1 UTSW 2 71,239,357 (GRCm39) missense possibly damaging 0.67
R6075:Hat1 UTSW 2 71,240,585 (GRCm39) missense probably benign 0.29
R6621:Hat1 UTSW 2 71,252,059 (GRCm39) missense probably benign 0.00
R7155:Hat1 UTSW 2 71,251,595 (GRCm39) missense possibly damaging 0.95
R7506:Hat1 UTSW 2 71,250,691 (GRCm39) missense probably damaging 1.00
R7644:Hat1 UTSW 2 71,240,525 (GRCm39) missense probably damaging 1.00
R8255:Hat1 UTSW 2 71,239,347 (GRCm39) missense probably damaging 1.00
R8890:Hat1 UTSW 2 71,269,137 (GRCm39) missense probably damaging 1.00
R9387:Hat1 UTSW 2 71,264,512 (GRCm39) missense possibly damaging 0.62
R9786:Hat1 UTSW 2 71,250,959 (GRCm39) missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- ACCATTTCTAGCCCCTACTACTTAAAG -3'
(R):5'- GCGGTGGTATTTCACAAGCC -3'

Sequencing Primer
(F):5'- TCTAGCCCCTACTACTTAAAGATTTC -3'
(R):5'- TTTCACAAGCCATCTTTTATTAATGC -3'
Posted On 2021-10-11