Mutagenetix > Incidental Mutation

Incidental Mutation 'R9002:Axl'

685023

Institutional Source

Beutler Lab

Gene Symbol

Axl

Ensembl Gene

ENSMUSG00000002602

Gene Name

AXL receptor tyrosine kinase

Synonyms

Tyro7, Ufo, Ark

Accession Numbers

Genbank: NM_009465; MGI: 1347244

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9002 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25757273-25788705 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25778678 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 199 (C199S)

Ref Sequence

ENSEMBL: ENSMUSP00000002677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]

AlphaFold

Q00993

Predicted Effect

probably damaging
Transcript: ENSMUST00000002677
AA Change: C199S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602
AA Change: C199S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	444	466	N/A	INTRINSIC
low complexity region	489	501	N/A	INTRINSIC
TyrKc	530	797	1.91e-134	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085948
AA Change: C199S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602
AA Change: C199S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	435	457	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
TyrKc	521	788	1.91e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132038

SMART Domains

Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
Blast:FN3	2	42	8e-20	BLAST
SCOP:d1gh7a2	2	61	4e-7	SMART
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	113	125	N/A	INTRINSIC
Pfam:Pkinase_Tyr	154	188	4.1e-6	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,291,926	M1263K	possibly damaging	Het
Abca8b	C	T	11: 109,952,630	D985N	probably benign	Het
Ak5	A	T	3: 152,653,454	M207K	probably damaging	Het
Akt1	T	C	12: 112,659,614	I75V	probably benign	Het
Ank	T	A	15: 27,544,327	L58*	probably null	Het
Ap1g1	A	C	8: 109,855,106	T666P	probably benign	Het
Ap3b2	A	T	7: 81,467,444	S615T	probably benign	Het
Ash1l	G	T	3: 88,981,408	R198L	probably benign	Het
C1d	T	C	11: 17,262,787	L44S	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Col4a4	A	G	1: 82,471,311	L1186P	probably benign	Het
Ctdsp2	T	A	10: 126,996,192	I223N	probably damaging	Het
Eml1	T	A	12: 108,538,179	I799N	probably damaging	Het
Fbxw18	G	A	9: 109,690,592	T282I	probably damaging	Het
Fmo2	A	T	1: 162,878,078	C397*	probably null	Het
Gbp10	C	A	5: 105,221,981	V262L	probably benign	Het
Gm11639	A	T	11: 105,029,996	D4671V	probably damaging	Het
Gm45871	A	T	18: 90,591,844	H402L	probably damaging	Het
Has1	T	C	17: 17,843,650	S576G	unknown	Het
Hat1	C	T	2: 71,441,303	R407W	probably damaging	Het
Hivep2	G	T	10: 14,132,413	R1585L	probably benign	Het
Ifi211	A	G	1: 173,906,328	V89A	possibly damaging	Het
Igkv4-59	T	C	6: 69,438,491	T27A	possibly damaging	Het
Irf9	T	A	14: 55,607,683	N333K	possibly damaging	Het
Jakmip2	C	T	18: 43,582,258	V68I	probably benign	Het
Kif1b	T	G	4: 149,191,255	I1400L	probably damaging	Het
Kif2b	C	T	11: 91,576,227	C410Y	probably benign	Het
Klk1b16	T	C	7: 44,140,765	L153P	possibly damaging	Het
Kndc1	C	T	7: 139,927,795	S1222F	possibly damaging	Het
Lama5	A	G	2: 180,196,518	C855R	probably damaging	Het
Mast3	A	G	8: 70,781,260	L947P	probably damaging	Het
Mblac2	C	A	13: 81,711,953	A142E	possibly damaging	Het
Mppe1	A	G	18: 67,225,854	S348P	possibly damaging	Het
Mroh8	A	C	2: 157,217,019	V909G	probably damaging	Het
Mthfd1	C	T	12: 76,303,980	T712M	probably benign	Het
Nek10	T	C	14: 14,980,590	L982P	probably damaging	Het
Nlrp4b	C	T	7: 10,714,959	T363I	probably damaging	Het
Nol10	A	G	12: 17,358,133	E120G	probably damaging	Het
Olfml1	T	C	7: 107,590,216	S163P	probably damaging	Het
Olfr1104	T	C	2: 87,021,897	T216A	probably benign	Het
Olfr135	A	T	17: 38,208,664	N140Y	probably benign	Het
Olfr522	T	C	7: 140,162,285	I222V	probably damaging	Het
Olfr576	A	T	7: 102,965,411	I104F	probably damaging	Het
Olfr902	T	A	9: 38,448,875	M1K	probably null	Het
Pde6a	T	A	18: 61,285,989	L812Q	probably damaging	Het
Pdxp	T	A	15: 78,918,259	M231K	probably damaging	Het
Pi4ka	A	G	16: 17,299,453	L1368P		Het
Ppie	T	C	4: 123,130,551	N171S	possibly damaging	Het
Rimbp2	T	C	5: 128,788,292	H657R	probably benign	Het
Sarnp	T	A	10: 128,821,973		probably null	Het
Serpinb9c	T	C	13: 33,150,346	T266A	probably damaging	Het
Srgap3	T	A	6: 112,780,893	I218F	possibly damaging	Het
Susd1	C	A	4: 59,324,882	W717L	probably benign	Het
Tgfbi	A	G	13: 56,623,589	Y88C	probably damaging	Het
Tmc6	A	T	11: 117,770,482	F624Y	probably damaging	Het
Tnni2	A	G	7: 142,444,276	E172G	probably damaging	Het
Traf3ip1	T	C	1: 91,505,456	S316P	probably benign	Het
Tshr	C	A	12: 91,537,774	N495K	possibly damaging	Het
Ulk3	C	A	9: 57,593,259	A317E	probably damaging	Het
Usp24	T	C	4: 106,418,215	V2229A	possibly damaging	Het
Usp32	G	A	11: 85,053,951	R304C	probably damaging	Het
Usp40	C	T	1: 88,007,341	G28D	probably benign	Het
Vmn1r41	A	G	6: 89,747,127	K217E	possibly damaging	Het
Vmn2r73	T	A	7: 85,858,076	K676M	probably benign	Het
Vnn1	A	G	10: 23,899,451	T200A	possibly damaging	Het
Zc3hav1	A	G	6: 38,325,241	L698P	possibly damaging	Het

Other mutations in Axl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Axl	APN	7	25785899	missense	probably benign	0.16
IGL00428:Axl	APN	7	25760872	missense	probably damaging	1.00
IGL00725:Axl	APN	7	25764483	missense	probably damaging	0.97
IGL01348:Axl	APN	7	25763309	missense	probably damaging	1.00
IGL01350:Axl	APN	7	25758750	missense	probably damaging	1.00
IGL01357:Axl	APN	7	25774169	missense	probably benign	0.00
IGL02314:Axl	APN	7	25786920	missense	possibly damaging	0.50
IGL02321:Axl	APN	7	25758769	missense	probably damaging	1.00
IGL02839:Axl	APN	7	25766791	critical splice donor site	probably null
IGL02878:Axl	APN	7	25758877	missense	probably damaging	0.99
R0125:Axl	UTSW	7	25786943	missense	probably benign	0.00
R0529:Axl	UTSW	7	25787287	splice site	probably benign
R0539:Axl	UTSW	7	25778717	unclassified	probably benign
R0614:Axl	UTSW	7	25774163	missense	probably benign	0.18
R0747:Axl	UTSW	7	25764059	missense	possibly damaging	0.95
R1599:Axl	UTSW	7	25763969	missense	probably damaging	0.99
R1727:Axl	UTSW	7	25760766	missense	possibly damaging	0.68
R1880:Axl	UTSW	7	25774548	missense	probably damaging	1.00
R2206:Axl	UTSW	7	25770636	missense	probably damaging	1.00
R2513:Axl	UTSW	7	25787516	missense	probably benign
R2877:Axl	UTSW	7	25766524	missense	probably damaging	0.96
R3802:Axl	UTSW	7	25788477	start codon destroyed	probably null	0.98
R3915:Axl	UTSW	7	25760744	splice site	probably benign
R4064:Axl	UTSW	7	25764020	missense	probably benign	0.36
R4072:Axl	UTSW	7	25763911	unclassified	probably benign
R4073:Axl	UTSW	7	25763911	unclassified	probably benign
R4074:Axl	UTSW	7	25763911	unclassified	probably benign
R4378:Axl	UTSW	7	25758837	missense	probably benign	0.06
R5039:Axl	UTSW	7	25785915	missense	probably damaging	1.00
R5224:Axl	UTSW	7	25786944	missense	probably benign	0.00
R5328:Axl	UTSW	7	25773411	missense	probably damaging	1.00
R5519:Axl	UTSW	7	25778662	missense	possibly damaging	0.93
R5885:Axl	UTSW	7	25766852	missense	probably damaging	1.00
R6367:Axl	UTSW	7	25787433	missense	probably damaging	1.00
R6447:Axl	UTSW	7	25770283	missense	probably damaging	0.96
R6931:Axl	UTSW	7	25761433	missense	probably damaging	1.00
R7172:Axl	UTSW	7	25786974	missense	probably benign	0.33
R7355:Axl	UTSW	7	25774106	missense	probably benign	0.22
R7410:Axl	UTSW	7	25758783	missense	probably benign	0.06
R8274:Axl	UTSW	7	25764013	missense	probably damaging	0.99
R8279:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8281:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8282:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8283:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8546:Axl	UTSW	7	25774163	missense	probably benign	0.00
R8742:Axl	UTSW	7	25764436	missense	probably damaging	0.99
R9139:Axl	UTSW	7	25761421	missense	probably damaging	1.00
R9179:Axl	UTSW	7	25770233	missense	probably damaging	0.97
R9324:Axl	UTSW	7	25761557	missense	probably damaging	1.00
R9343:Axl	UTSW	7	25774119	missense	probably damaging	1.00
R9352:Axl	UTSW	7	25763327	missense	possibly damaging	0.73
X0027:Axl	UTSW	7	25770268	missense	probably damaging	1.00
Z1177:Axl	UTSW	7	25761526	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAAGGGAAGGCTGACTCTTAG -3'
(R):5'- GTGTACCATCTGGCTCTGTAC -3'

Sequencing Primer
(F):5'- GAAGGCTGACTCTTAGGAAACTCTC -3'
(R):5'- TGGCTCTGTACATGTGAACAC -3'

Posted On

2021-10-11