Incidental Mutation 'R9002:Ap3b2'
ID 685025
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81117192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 615 (S615T)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
AlphaFold Q9JME5
Predicted Effect probably benign
Transcript: ENSMUST00000082090
AA Change: S615T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: S615T

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,241,926 (GRCm39) M1263K possibly damaging Het
Abca8b C T 11: 109,843,456 (GRCm39) D985N probably benign Het
Ak5 A T 3: 152,359,091 (GRCm39) M207K probably damaging Het
Akt1 T C 12: 112,626,048 (GRCm39) I75V probably benign Het
Ank T A 15: 27,544,413 (GRCm39) L58* probably null Het
Ap1g1 A C 8: 110,581,738 (GRCm39) T666P probably benign Het
Ash1l G T 3: 88,888,715 (GRCm39) R198L probably benign Het
Axl A T 7: 25,478,103 (GRCm39) C199S probably damaging Het
C1d T C 11: 17,212,787 (GRCm39) L44S probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Col4a4 A G 1: 82,449,032 (GRCm39) L1186P probably benign Het
Ctdsp2 T A 10: 126,832,061 (GRCm39) I223N probably damaging Het
Efcab3 A T 11: 104,920,822 (GRCm39) D4671V probably damaging Het
Eml1 T A 12: 108,504,438 (GRCm39) I799N probably damaging Het
Fbxw18 G A 9: 109,519,660 (GRCm39) T282I probably damaging Het
Fmo2 A T 1: 162,705,647 (GRCm39) C397* probably null Het
Gbp10 C A 5: 105,369,847 (GRCm39) V262L probably benign Het
Gm45871 A T 18: 90,609,968 (GRCm39) H402L probably damaging Het
Has1 T C 17: 18,063,912 (GRCm39) S576G unknown Het
Hat1 C T 2: 71,271,647 (GRCm39) R407W probably damaging Het
Hivep2 G T 10: 14,008,157 (GRCm39) R1585L probably benign Het
Ifi211 A G 1: 173,733,894 (GRCm39) V89A possibly damaging Het
Igkv4-59 T C 6: 69,415,475 (GRCm39) T27A possibly damaging Het
Irf9 T A 14: 55,845,140 (GRCm39) N333K possibly damaging Het
Jakmip2 C T 18: 43,715,323 (GRCm39) V68I probably benign Het
Kif1b T G 4: 149,275,712 (GRCm39) I1400L probably damaging Het
Kif2b C T 11: 91,467,053 (GRCm39) C410Y probably benign Het
Klk1b16 T C 7: 43,790,189 (GRCm39) L153P possibly damaging Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lama5 A G 2: 179,838,311 (GRCm39) C855R probably damaging Het
Mast3 A G 8: 71,233,904 (GRCm39) L947P probably damaging Het
Mblac2 C A 13: 81,860,072 (GRCm39) A142E possibly damaging Het
Mppe1 A G 18: 67,358,925 (GRCm39) S348P possibly damaging Het
Mroh8 A C 2: 157,058,939 (GRCm39) V909G probably damaging Het
Mthfd1 C T 12: 76,350,754 (GRCm39) T712M probably benign Het
Nek10 T C 14: 14,980,590 (GRCm38) L982P probably damaging Het
Nlrp4b C T 7: 10,448,886 (GRCm39) T363I probably damaging Het
Nol10 A G 12: 17,408,134 (GRCm39) E120G probably damaging Het
Olfml1 T C 7: 107,189,423 (GRCm39) S163P probably damaging Het
Or2n1c A T 17: 38,519,555 (GRCm39) N140Y probably benign Het
Or51a7 A T 7: 102,614,618 (GRCm39) I104F probably damaging Het
Or6ae1 T C 7: 139,742,198 (GRCm39) I222V probably damaging Het
Or8b43 T A 9: 38,360,171 (GRCm39) M1K probably null Het
Or8i2 T C 2: 86,852,241 (GRCm39) T216A probably benign Het
Pde6a T A 18: 61,419,060 (GRCm39) L812Q probably damaging Het
Pdxp T A 15: 78,802,459 (GRCm39) M231K probably damaging Het
Pi4ka A G 16: 17,117,317 (GRCm39) L1368P Het
Ppie T C 4: 123,024,344 (GRCm39) N171S possibly damaging Het
Rimbp2 T C 5: 128,865,356 (GRCm39) H657R probably benign Het
Sarnp T A 10: 128,657,842 (GRCm39) probably null Het
Serpinb9c T C 13: 33,334,329 (GRCm39) T266A probably damaging Het
Srgap3 T A 6: 112,757,854 (GRCm39) I218F possibly damaging Het
Susd1 C A 4: 59,324,882 (GRCm39) W717L probably benign Het
Tgfbi A G 13: 56,771,402 (GRCm39) Y88C probably damaging Het
Tmc6 A T 11: 117,661,308 (GRCm39) F624Y probably damaging Het
Tnni2 A G 7: 141,998,013 (GRCm39) E172G probably damaging Het
Traf3ip1 T C 1: 91,433,178 (GRCm39) S316P probably benign Het
Tshr C A 12: 91,504,548 (GRCm39) N495K possibly damaging Het
Ulk3 C A 9: 57,500,542 (GRCm39) A317E probably damaging Het
Usp24 T C 4: 106,275,412 (GRCm39) V2229A possibly damaging Het
Usp32 G A 11: 84,944,777 (GRCm39) R304C probably damaging Het
Usp40 C T 1: 87,935,063 (GRCm39) G28D probably benign Het
Vmn1r41 A G 6: 89,724,109 (GRCm39) K217E possibly damaging Het
Vmn2r73 T A 7: 85,507,284 (GRCm39) K676M probably benign Het
Vnn1 A G 10: 23,775,349 (GRCm39) T200A possibly damaging Het
Zc3hav1 A G 6: 38,302,176 (GRCm39) L698P possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAACCAGCCATGACTGTG -3'
(R):5'- ACCCTCTGTTGTCTGCTGAG -3'

Sequencing Primer
(F):5'- AGCCATGACTGTGGTGGAC -3'
(R):5'- TCTGCAGACCAAGCTCTTGAC -3'
Posted On 2021-10-11