Incidental Mutation 'R9002:Mast3'
ID 685032
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71233904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 947 (L947P)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: L963P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: L963P

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: L947P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,241,926 (GRCm39) M1263K possibly damaging Het
Abca8b C T 11: 109,843,456 (GRCm39) D985N probably benign Het
Ak5 A T 3: 152,359,091 (GRCm39) M207K probably damaging Het
Akt1 T C 12: 112,626,048 (GRCm39) I75V probably benign Het
Ank T A 15: 27,544,413 (GRCm39) L58* probably null Het
Ap1g1 A C 8: 110,581,738 (GRCm39) T666P probably benign Het
Ap3b2 A T 7: 81,117,192 (GRCm39) S615T probably benign Het
Ash1l G T 3: 88,888,715 (GRCm39) R198L probably benign Het
Axl A T 7: 25,478,103 (GRCm39) C199S probably damaging Het
C1d T C 11: 17,212,787 (GRCm39) L44S probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Col4a4 A G 1: 82,449,032 (GRCm39) L1186P probably benign Het
Ctdsp2 T A 10: 126,832,061 (GRCm39) I223N probably damaging Het
Efcab3 A T 11: 104,920,822 (GRCm39) D4671V probably damaging Het
Eml1 T A 12: 108,504,438 (GRCm39) I799N probably damaging Het
Fbxw18 G A 9: 109,519,660 (GRCm39) T282I probably damaging Het
Fmo2 A T 1: 162,705,647 (GRCm39) C397* probably null Het
Gbp10 C A 5: 105,369,847 (GRCm39) V262L probably benign Het
Gm45871 A T 18: 90,609,968 (GRCm39) H402L probably damaging Het
Has1 T C 17: 18,063,912 (GRCm39) S576G unknown Het
Hat1 C T 2: 71,271,647 (GRCm39) R407W probably damaging Het
Hivep2 G T 10: 14,008,157 (GRCm39) R1585L probably benign Het
Ifi211 A G 1: 173,733,894 (GRCm39) V89A possibly damaging Het
Igkv4-59 T C 6: 69,415,475 (GRCm39) T27A possibly damaging Het
Irf9 T A 14: 55,845,140 (GRCm39) N333K possibly damaging Het
Jakmip2 C T 18: 43,715,323 (GRCm39) V68I probably benign Het
Kif1b T G 4: 149,275,712 (GRCm39) I1400L probably damaging Het
Kif2b C T 11: 91,467,053 (GRCm39) C410Y probably benign Het
Klk1b16 T C 7: 43,790,189 (GRCm39) L153P possibly damaging Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lama5 A G 2: 179,838,311 (GRCm39) C855R probably damaging Het
Mblac2 C A 13: 81,860,072 (GRCm39) A142E possibly damaging Het
Mppe1 A G 18: 67,358,925 (GRCm39) S348P possibly damaging Het
Mroh8 A C 2: 157,058,939 (GRCm39) V909G probably damaging Het
Mthfd1 C T 12: 76,350,754 (GRCm39) T712M probably benign Het
Nek10 T C 14: 14,980,590 (GRCm38) L982P probably damaging Het
Nlrp4b C T 7: 10,448,886 (GRCm39) T363I probably damaging Het
Nol10 A G 12: 17,408,134 (GRCm39) E120G probably damaging Het
Olfml1 T C 7: 107,189,423 (GRCm39) S163P probably damaging Het
Or2n1c A T 17: 38,519,555 (GRCm39) N140Y probably benign Het
Or51a7 A T 7: 102,614,618 (GRCm39) I104F probably damaging Het
Or6ae1 T C 7: 139,742,198 (GRCm39) I222V probably damaging Het
Or8b43 T A 9: 38,360,171 (GRCm39) M1K probably null Het
Or8i2 T C 2: 86,852,241 (GRCm39) T216A probably benign Het
Pde6a T A 18: 61,419,060 (GRCm39) L812Q probably damaging Het
Pdxp T A 15: 78,802,459 (GRCm39) M231K probably damaging Het
Pi4ka A G 16: 17,117,317 (GRCm39) L1368P Het
Ppie T C 4: 123,024,344 (GRCm39) N171S possibly damaging Het
Rimbp2 T C 5: 128,865,356 (GRCm39) H657R probably benign Het
Sarnp T A 10: 128,657,842 (GRCm39) probably null Het
Serpinb9c T C 13: 33,334,329 (GRCm39) T266A probably damaging Het
Srgap3 T A 6: 112,757,854 (GRCm39) I218F possibly damaging Het
Susd1 C A 4: 59,324,882 (GRCm39) W717L probably benign Het
Tgfbi A G 13: 56,771,402 (GRCm39) Y88C probably damaging Het
Tmc6 A T 11: 117,661,308 (GRCm39) F624Y probably damaging Het
Tnni2 A G 7: 141,998,013 (GRCm39) E172G probably damaging Het
Traf3ip1 T C 1: 91,433,178 (GRCm39) S316P probably benign Het
Tshr C A 12: 91,504,548 (GRCm39) N495K possibly damaging Het
Ulk3 C A 9: 57,500,542 (GRCm39) A317E probably damaging Het
Usp24 T C 4: 106,275,412 (GRCm39) V2229A possibly damaging Het
Usp32 G A 11: 84,944,777 (GRCm39) R304C probably damaging Het
Usp40 C T 1: 87,935,063 (GRCm39) G28D probably benign Het
Vmn1r41 A G 6: 89,724,109 (GRCm39) K217E possibly damaging Het
Vmn2r73 T A 7: 85,507,284 (GRCm39) K676M probably benign Het
Vnn1 A G 10: 23,775,349 (GRCm39) T200A possibly damaging Het
Zc3hav1 A G 6: 38,302,176 (GRCm39) L698P possibly damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATGGCAAGCACCCTGATTC -3'
(R):5'- GGGTGCTTCTAGAACTGGAC -3'

Sequencing Primer
(F):5'- TGATTCCCACAGCCAGGTC -3'
(R):5'- TGCTTCTAGAACTGGACACAAGGC -3'
Posted On 2021-10-11