Incidental Mutation 'R9002:Usp32'
ID 685043
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85053951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 304 (R304C)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: R304C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: R304C

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,926 M1263K possibly damaging Het
Abca8b C T 11: 109,952,630 D985N probably benign Het
Ak5 A T 3: 152,653,454 M207K probably damaging Het
Akt1 T C 12: 112,659,614 I75V probably benign Het
Ank T A 15: 27,544,327 L58* probably null Het
Ap1g1 A C 8: 109,855,106 T666P probably benign Het
Ap3b2 A T 7: 81,467,444 S615T probably benign Het
Ash1l G T 3: 88,981,408 R198L probably benign Het
Axl A T 7: 25,778,678 C199S probably damaging Het
C1d T C 11: 17,262,787 L44S probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col4a4 A G 1: 82,471,311 L1186P probably benign Het
Ctdsp2 T A 10: 126,996,192 I223N probably damaging Het
Eml1 T A 12: 108,538,179 I799N probably damaging Het
Fbxw18 G A 9: 109,690,592 T282I probably damaging Het
Fmo2 A T 1: 162,878,078 C397* probably null Het
Gbp10 C A 5: 105,221,981 V262L probably benign Het
Gm11639 A T 11: 105,029,996 D4671V probably damaging Het
Gm45871 A T 18: 90,591,844 H402L probably damaging Het
Has1 T C 17: 17,843,650 S576G unknown Het
Hat1 C T 2: 71,441,303 R407W probably damaging Het
Hivep2 G T 10: 14,132,413 R1585L probably benign Het
Ifi211 A G 1: 173,906,328 V89A possibly damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Irf9 T A 14: 55,607,683 N333K possibly damaging Het
Jakmip2 C T 18: 43,582,258 V68I probably benign Het
Kif1b T G 4: 149,191,255 I1400L probably damaging Het
Kif2b C T 11: 91,576,227 C410Y probably benign Het
Klk1b16 T C 7: 44,140,765 L153P possibly damaging Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lama5 A G 2: 180,196,518 C855R probably damaging Het
Mast3 A G 8: 70,781,260 L947P probably damaging Het
Mblac2 C A 13: 81,711,953 A142E possibly damaging Het
Mppe1 A G 18: 67,225,854 S348P possibly damaging Het
Mroh8 A C 2: 157,217,019 V909G probably damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nek10 T C 14: 14,980,590 L982P probably damaging Het
Nlrp4b C T 7: 10,714,959 T363I probably damaging Het
Nol10 A G 12: 17,358,133 E120G probably damaging Het
Olfml1 T C 7: 107,590,216 S163P probably damaging Het
Olfr1104 T C 2: 87,021,897 T216A probably benign Het
Olfr135 A T 17: 38,208,664 N140Y probably benign Het
Olfr522 T C 7: 140,162,285 I222V probably damaging Het
Olfr576 A T 7: 102,965,411 I104F probably damaging Het
Olfr902 T A 9: 38,448,875 M1K probably null Het
Pde6a T A 18: 61,285,989 L812Q probably damaging Het
Pdxp T A 15: 78,918,259 M231K probably damaging Het
Pi4ka A G 16: 17,299,453 L1368P Het
Ppie T C 4: 123,130,551 N171S possibly damaging Het
Rimbp2 T C 5: 128,788,292 H657R probably benign Het
Sarnp T A 10: 128,821,973 probably null Het
Serpinb9c T C 13: 33,150,346 T266A probably damaging Het
Srgap3 T A 6: 112,780,893 I218F possibly damaging Het
Susd1 C A 4: 59,324,882 W717L probably benign Het
Tgfbi A G 13: 56,623,589 Y88C probably damaging Het
Tmc6 A T 11: 117,770,482 F624Y probably damaging Het
Tnni2 A G 7: 142,444,276 E172G probably damaging Het
Traf3ip1 T C 1: 91,505,456 S316P probably benign Het
Tshr C A 12: 91,537,774 N495K possibly damaging Het
Ulk3 C A 9: 57,593,259 A317E probably damaging Het
Usp24 T C 4: 106,418,215 V2229A possibly damaging Het
Usp40 C T 1: 88,007,341 G28D probably benign Het
Vmn1r41 A G 6: 89,747,127 K217E possibly damaging Het
Vmn2r73 T A 7: 85,858,076 K676M probably benign Het
Vnn1 A G 10: 23,899,451 T200A possibly damaging Het
Zc3hav1 A G 6: 38,325,241 L698P possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGTCTCACCTTTGTG -3'
(R):5'- GGGTAGCTTCTAATGAAATGCATC -3'

Sequencing Primer
(F):5'- GTGGTATCATGTGCATTCAATATCC -3'
(R):5'- GCTTCTAATGAAATGCATCATAGTTC -3'
Posted On 2021-10-11