Incidental Mutation 'R9002:Tmc6'
ID 685047
Institutional Source Beutler Lab
Gene Symbol Tmc6
Ensembl Gene ENSMUSG00000025572
Gene Name transmembrane channel-like gene family 6
Synonyms D11Ertd204e, EVER1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 117765988-117782198 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117770482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 624 (F624Y)
Ref Sequence ENSEMBL: ENSMUSP00000026659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000103025] [ENSMUST00000131606]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026659
AA Change: F624Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572
AA Change: F624Y

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103025
SMART Domains Protein: ENSMUSP00000099314
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131606
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149589
SMART Domains Protein: ENSMUSP00000116521
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
Pfam:TMC 61 108 1.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,926 M1263K possibly damaging Het
Abca8b C T 11: 109,952,630 D985N probably benign Het
Ak5 A T 3: 152,653,454 M207K probably damaging Het
Akt1 T C 12: 112,659,614 I75V probably benign Het
Ank T A 15: 27,544,327 L58* probably null Het
Ap1g1 A C 8: 109,855,106 T666P probably benign Het
Ap3b2 A T 7: 81,467,444 S615T probably benign Het
Ash1l G T 3: 88,981,408 R198L probably benign Het
Axl A T 7: 25,778,678 C199S probably damaging Het
C1d T C 11: 17,262,787 L44S probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col4a4 A G 1: 82,471,311 L1186P probably benign Het
Ctdsp2 T A 10: 126,996,192 I223N probably damaging Het
Eml1 T A 12: 108,538,179 I799N probably damaging Het
Fbxw18 G A 9: 109,690,592 T282I probably damaging Het
Fmo2 A T 1: 162,878,078 C397* probably null Het
Gbp10 C A 5: 105,221,981 V262L probably benign Het
Gm11639 A T 11: 105,029,996 D4671V probably damaging Het
Gm45871 A T 18: 90,591,844 H402L probably damaging Het
Has1 T C 17: 17,843,650 S576G unknown Het
Hat1 C T 2: 71,441,303 R407W probably damaging Het
Hivep2 G T 10: 14,132,413 R1585L probably benign Het
Ifi211 A G 1: 173,906,328 V89A possibly damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Irf9 T A 14: 55,607,683 N333K possibly damaging Het
Jakmip2 C T 18: 43,582,258 V68I probably benign Het
Kif1b T G 4: 149,191,255 I1400L probably damaging Het
Kif2b C T 11: 91,576,227 C410Y probably benign Het
Klk1b16 T C 7: 44,140,765 L153P possibly damaging Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lama5 A G 2: 180,196,518 C855R probably damaging Het
Mast3 A G 8: 70,781,260 L947P probably damaging Het
Mblac2 C A 13: 81,711,953 A142E possibly damaging Het
Mppe1 A G 18: 67,225,854 S348P possibly damaging Het
Mroh8 A C 2: 157,217,019 V909G probably damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nek10 T C 14: 14,980,590 L982P probably damaging Het
Nlrp4b C T 7: 10,714,959 T363I probably damaging Het
Nol10 A G 12: 17,358,133 E120G probably damaging Het
Olfml1 T C 7: 107,590,216 S163P probably damaging Het
Olfr1104 T C 2: 87,021,897 T216A probably benign Het
Olfr135 A T 17: 38,208,664 N140Y probably benign Het
Olfr522 T C 7: 140,162,285 I222V probably damaging Het
Olfr576 A T 7: 102,965,411 I104F probably damaging Het
Olfr902 T A 9: 38,448,875 M1K probably null Het
Pde6a T A 18: 61,285,989 L812Q probably damaging Het
Pdxp T A 15: 78,918,259 M231K probably damaging Het
Pi4ka A G 16: 17,299,453 L1368P Het
Ppie T C 4: 123,130,551 N171S possibly damaging Het
Rimbp2 T C 5: 128,788,292 H657R probably benign Het
Sarnp T A 10: 128,821,973 probably null Het
Serpinb9c T C 13: 33,150,346 T266A probably damaging Het
Srgap3 T A 6: 112,780,893 I218F possibly damaging Het
Susd1 C A 4: 59,324,882 W717L probably benign Het
Tgfbi A G 13: 56,623,589 Y88C probably damaging Het
Tnni2 A G 7: 142,444,276 E172G probably damaging Het
Traf3ip1 T C 1: 91,505,456 S316P probably benign Het
Tshr C A 12: 91,537,774 N495K possibly damaging Het
Ulk3 C A 9: 57,593,259 A317E probably damaging Het
Usp24 T C 4: 106,418,215 V2229A possibly damaging Het
Usp32 G A 11: 85,053,951 R304C probably damaging Het
Usp40 C T 1: 88,007,341 G28D probably benign Het
Vmn1r41 A G 6: 89,747,127 K217E possibly damaging Het
Vmn2r73 T A 7: 85,858,076 K676M probably benign Het
Vnn1 A G 10: 23,899,451 T200A possibly damaging Het
Zc3hav1 A G 6: 38,325,241 L698P possibly damaging Het
Other mutations in Tmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Tmc6 APN 11 117779046 missense probably damaging 0.99
IGL02637:Tmc6 APN 11 117767590 missense possibly damaging 0.94
PIT4520001:Tmc6 UTSW 11 117772730 missense possibly damaging 0.55
R0140:Tmc6 UTSW 11 117766251 unclassified probably benign
R0149:Tmc6 UTSW 11 117769448 missense probably damaging 1.00
R0437:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R1566:Tmc6 UTSW 11 117769436 missense probably damaging 0.99
R2011:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2012:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2169:Tmc6 UTSW 11 117769106 missense probably damaging 1.00
R2568:Tmc6 UTSW 11 117772820 missense probably benign 0.08
R3853:Tmc6 UTSW 11 117773058 nonsense probably null
R4049:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R4655:Tmc6 UTSW 11 117773042 missense possibly damaging 0.62
R4708:Tmc6 UTSW 11 117768948 missense probably benign 0.00
R5001:Tmc6 UTSW 11 117770784 missense probably benign 0.28
R5115:Tmc6 UTSW 11 117775188 missense probably damaging 0.98
R5551:Tmc6 UTSW 11 117769445 missense probably damaging 1.00
R5667:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5671:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5763:Tmc6 UTSW 11 117769433 missense possibly damaging 0.90
R6137:Tmc6 UTSW 11 117776328 missense probably damaging 1.00
R6354:Tmc6 UTSW 11 117774236 missense probably benign 0.32
R6418:Tmc6 UTSW 11 117770500 missense probably damaging 0.99
R6868:Tmc6 UTSW 11 117774317 missense probably benign 0.01
R7006:Tmc6 UTSW 11 117774257 missense probably damaging 0.96
R7208:Tmc6 UTSW 11 117776325 missense probably benign 0.41
R7210:Tmc6 UTSW 11 117775844 missense possibly damaging 0.59
R7633:Tmc6 UTSW 11 117769220 missense probably benign
R8802:Tmc6 UTSW 11 117775075 missense possibly damaging 0.81
R8959:Tmc6 UTSW 11 117770467 critical splice donor site probably null
R9621:Tmc6 UTSW 11 117779169 missense probably benign 0.00
Z1177:Tmc6 UTSW 11 117778747 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACTCTGCTACCAAGTTAGC -3'
(R):5'- ACAGACACTGACCTGGTGAG -3'

Sequencing Primer
(F):5'- ACCAAGTTAGCATCTTTTTCAGGGG -3'
(R):5'- ACCTGGTGAGGGTCTCCC -3'
Posted On 2021-10-11