Mutagenetix > Incidental Mutation

Incidental Mutation 'R9002:Eml1'

685051

Institutional Source

Beutler Lab

Gene Symbol

Eml1

Ensembl Gene

ENSMUSG00000058070

Gene Name

echinoderm microtubule associated protein like 1

Synonyms

A930030P13Rik, ELP79, 1110008N23Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R9002 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108370957-108539617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108538179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 799 (I799N)

Ref Sequence

ENSEMBL: ENSMUSP00000105486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]

AlphaFold

Q05BC3

Predicted Effect

probably damaging
Transcript: ENSMUST00000054955
AA Change: I768N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: I768N

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	228	277	5.6e-3	SMART
WD40	280	325	2.21e1	SMART
WD40	328	367	4.46e-1	SMART
WD40	375	413	5.73e0	SMART
WD40	416	456	5.75e-1	SMART
WD40	496	539	4.24e-3	SMART
WD40	542	580	1.37e2	SMART
WD40	583	622	1.7e-2	SMART
WD40	629	668	1.58e-2	SMART
Blast:WD40	694	735	7e-20	BLAST
WD40	741	781	2.96e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109857
AA Change: I785N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: I785N

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	245	294	5.6e-3	SMART
WD40	297	342	2.21e1	SMART
WD40	345	384	4.46e-1	SMART
WD40	392	430	5.73e0	SMART
WD40	433	473	5.75e-1	SMART
WD40	513	556	4.24e-3	SMART
WD40	559	597	1.37e2	SMART
WD40	600	639	1.7e-2	SMART
WD40	646	685	1.58e-2	SMART
Blast:WD40	711	752	7e-20	BLAST
WD40	758	798	2.96e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109860
AA Change: I799N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: I799N

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
Pfam:HELP	184	258	1.8e-35	PFAM
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART
WD40	660	699	1.58e-2	SMART
Blast:WD40	725	766	7e-20	BLAST
WD40	772	812	2.96e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130999

SMART Domains

Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,291,926	M1263K	possibly damaging	Het
Abca8b	C	T	11: 109,952,630	D985N	probably benign	Het
Ak5	A	T	3: 152,653,454	M207K	probably damaging	Het
Akt1	T	C	12: 112,659,614	I75V	probably benign	Het
Ank	T	A	15: 27,544,327	L58*	probably null	Het
Ap1g1	A	C	8: 109,855,106	T666P	probably benign	Het
Ap3b2	A	T	7: 81,467,444	S615T	probably benign	Het
Ash1l	G	T	3: 88,981,408	R198L	probably benign	Het
Axl	A	T	7: 25,778,678	C199S	probably damaging	Het
C1d	T	C	11: 17,262,787	L44S	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Col4a4	A	G	1: 82,471,311	L1186P	probably benign	Het
Ctdsp2	T	A	10: 126,996,192	I223N	probably damaging	Het
Fbxw18	G	A	9: 109,690,592	T282I	probably damaging	Het
Fmo2	A	T	1: 162,878,078	C397*	probably null	Het
Gbp10	C	A	5: 105,221,981	V262L	probably benign	Het
Gm11639	A	T	11: 105,029,996	D4671V	probably damaging	Het
Gm45871	A	T	18: 90,591,844	H402L	probably damaging	Het
Has1	T	C	17: 17,843,650	S576G	unknown	Het
Hat1	C	T	2: 71,441,303	R407W	probably damaging	Het
Hivep2	G	T	10: 14,132,413	R1585L	probably benign	Het
Ifi211	A	G	1: 173,906,328	V89A	possibly damaging	Het
Igkv4-59	T	C	6: 69,438,491	T27A	possibly damaging	Het
Irf9	T	A	14: 55,607,683	N333K	possibly damaging	Het
Jakmip2	C	T	18: 43,582,258	V68I	probably benign	Het
Kif1b	T	G	4: 149,191,255	I1400L	probably damaging	Het
Kif2b	C	T	11: 91,576,227	C410Y	probably benign	Het
Klk1b16	T	C	7: 44,140,765	L153P	possibly damaging	Het
Kndc1	C	T	7: 139,927,795	S1222F	possibly damaging	Het
Lama5	A	G	2: 180,196,518	C855R	probably damaging	Het
Mast3	A	G	8: 70,781,260	L947P	probably damaging	Het
Mblac2	C	A	13: 81,711,953	A142E	possibly damaging	Het
Mppe1	A	G	18: 67,225,854	S348P	possibly damaging	Het
Mroh8	A	C	2: 157,217,019	V909G	probably damaging	Het
Mthfd1	C	T	12: 76,303,980	T712M	probably benign	Het
Nek10	T	C	14: 14,980,590	L982P	probably damaging	Het
Nlrp4b	C	T	7: 10,714,959	T363I	probably damaging	Het
Nol10	A	G	12: 17,358,133	E120G	probably damaging	Het
Olfml1	T	C	7: 107,590,216	S163P	probably damaging	Het
Olfr1104	T	C	2: 87,021,897	T216A	probably benign	Het
Olfr135	A	T	17: 38,208,664	N140Y	probably benign	Het
Olfr522	T	C	7: 140,162,285	I222V	probably damaging	Het
Olfr576	A	T	7: 102,965,411	I104F	probably damaging	Het
Olfr902	T	A	9: 38,448,875	M1K	probably null	Het
Pde6a	T	A	18: 61,285,989	L812Q	probably damaging	Het
Pdxp	T	A	15: 78,918,259	M231K	probably damaging	Het
Pi4ka	A	G	16: 17,299,453	L1368P		Het
Ppie	T	C	4: 123,130,551	N171S	possibly damaging	Het
Rimbp2	T	C	5: 128,788,292	H657R	probably benign	Het
Sarnp	T	A	10: 128,821,973		probably null	Het
Serpinb9c	T	C	13: 33,150,346	T266A	probably damaging	Het
Srgap3	T	A	6: 112,780,893	I218F	possibly damaging	Het
Susd1	C	A	4: 59,324,882	W717L	probably benign	Het
Tgfbi	A	G	13: 56,623,589	Y88C	probably damaging	Het
Tmc6	A	T	11: 117,770,482	F624Y	probably damaging	Het
Tnni2	A	G	7: 142,444,276	E172G	probably damaging	Het
Traf3ip1	T	C	1: 91,505,456	S316P	probably benign	Het
Tshr	C	A	12: 91,537,774	N495K	possibly damaging	Het
Ulk3	C	A	9: 57,593,259	A317E	probably damaging	Het
Usp24	T	C	4: 106,418,215	V2229A	possibly damaging	Het
Usp32	G	A	11: 85,053,951	R304C	probably damaging	Het
Usp40	C	T	1: 88,007,341	G28D	probably benign	Het
Vmn1r41	A	G	6: 89,747,127	K217E	possibly damaging	Het
Vmn2r73	T	A	7: 85,858,076	K676M	probably benign	Het
Vnn1	A	G	10: 23,899,451	T200A	possibly damaging	Het
Zc3hav1	A	G	6: 38,325,241	L698P	possibly damaging	Het

Other mutations in Eml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Eml1	APN	12	108514515	splice site	probably null
IGL00774:Eml1	APN	12	108514515	splice site	probably null
IGL01358:Eml1	APN	12	108514468	missense	probably benign	0.05
IGL02316:Eml1	APN	12	108534759	intron	probably benign
IGL02346:Eml1	APN	12	108537441	missense	possibly damaging	0.87
IGL02480:Eml1	APN	12	108521696	missense	probably benign	0.32
IGL02513:Eml1	APN	12	108530312	missense	probably damaging	1.00
IGL02556:Eml1	APN	12	108537366	missense	probably benign	0.00
IGL02565:Eml1	APN	12	108506520	missense	probably damaging	1.00
IGL03217:Eml1	APN	12	108534942	missense	probably benign	0.31
bubble	UTSW	12	108513071	critical splice donor site	probably null
R0027:Eml1	UTSW	12	108536298	missense	possibly damaging	0.90
R0067:Eml1	UTSW	12	108463527	missense	possibly damaging	0.61
R0124:Eml1	UTSW	12	108506608	missense	probably benign	0.00
R0124:Eml1	UTSW	12	108509178	missense	probably damaging	1.00
R0730:Eml1	UTSW	12	108530326	missense	possibly damaging	0.79
R1566:Eml1	UTSW	12	108471892	missense	probably damaging	0.99
R1883:Eml1	UTSW	12	108463652	missense	probably damaging	0.97
R1927:Eml1	UTSW	12	108538217	nonsense	probably null
R1938:Eml1	UTSW	12	108521396	missense	possibly damaging	0.75
R2070:Eml1	UTSW	12	108512999	missense	probably damaging	1.00
R2311:Eml1	UTSW	12	108537416	missense	probably damaging	0.99
R2417:Eml1	UTSW	12	108536275	missense	probably benign	0.00
R3120:Eml1	UTSW	12	108513053	missense	probably benign	0.31
R4352:Eml1	UTSW	12	108534837	intron	probably benign
R4471:Eml1	UTSW	12	108506635	intron	probably benign
R4655:Eml1	UTSW	12	108534713	missense	probably damaging	1.00
R5077:Eml1	UTSW	12	108506612	splice site	probably benign
R5094:Eml1	UTSW	12	108536311	missense	probably benign	0.11
R5113:Eml1	UTSW	12	108537337	missense	possibly damaging	0.74
R5524:Eml1	UTSW	12	108521376	missense	probably damaging	0.99
R5775:Eml1	UTSW	12	108506554	missense	probably damaging	1.00
R6120:Eml1	UTSW	12	108527724	missense	probably damaging	1.00
R6224:Eml1	UTSW	12	108514508	missense	probably damaging	1.00
R6491:Eml1	UTSW	12	108513071	critical splice donor site	probably null
R7035:Eml1	UTSW	12	108509234	missense	probably damaging	1.00
R7134:Eml1	UTSW	12	108506551	missense	probably benign	0.00
R7273:Eml1	UTSW	12	108538173	missense	possibly damaging	0.87
R7606:Eml1	UTSW	12	108537366	missense	probably benign	0.45
R7744:Eml1	UTSW	12	108516604	missense	probably benign
R7820:Eml1	UTSW	12	108515174	missense	possibly damaging	0.81
R8013:Eml1	UTSW	12	108521679	missense	probably benign	0.18
R8223:Eml1	UTSW	12	108536310	missense	probably benign	0.00
R8258:Eml1	UTSW	12	108510199	missense	probably damaging	0.97
R8259:Eml1	UTSW	12	108510199	missense	probably damaging	0.97
R8399:Eml1	UTSW	12	108538131	missense	possibly damaging	0.91
R8427:Eml1	UTSW	12	108530321	missense	probably damaging	0.99
R9220:Eml1	UTSW	12	108514443	nonsense	probably null
R9432:Eml1	UTSW	12	108516583	missense	probably benign	0.00
R9446:Eml1	UTSW	12	108515206	missense	probably damaging	0.98
R9500:Eml1	UTSW	12	108527699	missense	probably damaging	1.00
Z1088:Eml1	UTSW	12	108537459	missense	possibly damaging	0.80
Z1177:Eml1	UTSW	12	108423139	start gained	probably benign
Z1177:Eml1	UTSW	12	108534656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGAGTCTTGCACACAAAGC -3'
(R):5'- CTGGCTCCCCAACTAAGGTAAC -3'

Sequencing Primer
(F):5'- GAGTCTTGCACACAAAGCTGACAC -3'
(R):5'- AACTGGTAGAGGGACAGTTTTCC -3'

Posted On

2021-10-11