Mutagenetix > Incidental Mutation

Incidental Mutation 'R9002:Nek10'

685056

Institutional Source

Beutler Lab

Gene Symbol

Nek10

Ensembl Gene

ENSMUSG00000042567

Gene Name

NIMA (never in mitosis gene a)- related kinase 10

Synonyms

LOC238944

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9002 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14803415-15012059 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14980590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 982 (L982P)

Ref Sequence

ENSEMBL: ENSMUSP00000108249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]

AlphaFold

Q3UGM2

Predicted Effect

probably damaging
Transcript: ENSMUST00000112630
AA Change: L982P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: L982P

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112631
AA Change: L993P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: L993P

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136826

SMART Domains

Protein: ENSMUSP00000123151
Gene: ENSMUSG00000042567

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	87	5.1e-13	PFAM
Pfam:Pkinase_Tyr	1	87	4.2e-8	PFAM
low complexity region	103	115	N/A	INTRINSIC
low complexity region	143	167	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224491
AA Change: L982P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,291,926	M1263K	possibly damaging	Het
Abca8b	C	T	11: 109,952,630	D985N	probably benign	Het
Ak5	A	T	3: 152,653,454	M207K	probably damaging	Het
Akt1	T	C	12: 112,659,614	I75V	probably benign	Het
Ank	T	A	15: 27,544,327	L58*	probably null	Het
Ap1g1	A	C	8: 109,855,106	T666P	probably benign	Het
Ap3b2	A	T	7: 81,467,444	S615T	probably benign	Het
Ash1l	G	T	3: 88,981,408	R198L	probably benign	Het
Axl	A	T	7: 25,778,678	C199S	probably damaging	Het
C1d	T	C	11: 17,262,787	L44S	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Col4a4	A	G	1: 82,471,311	L1186P	probably benign	Het
Ctdsp2	T	A	10: 126,996,192	I223N	probably damaging	Het
Eml1	T	A	12: 108,538,179	I799N	probably damaging	Het
Fbxw18	G	A	9: 109,690,592	T282I	probably damaging	Het
Fmo2	A	T	1: 162,878,078	C397*	probably null	Het
Gbp10	C	A	5: 105,221,981	V262L	probably benign	Het
Gm11639	A	T	11: 105,029,996	D4671V	probably damaging	Het
Gm45871	A	T	18: 90,591,844	H402L	probably damaging	Het
Has1	T	C	17: 17,843,650	S576G	unknown	Het
Hat1	C	T	2: 71,441,303	R407W	probably damaging	Het
Hivep2	G	T	10: 14,132,413	R1585L	probably benign	Het
Ifi211	A	G	1: 173,906,328	V89A	possibly damaging	Het
Igkv4-59	T	C	6: 69,438,491	T27A	possibly damaging	Het
Irf9	T	A	14: 55,607,683	N333K	possibly damaging	Het
Jakmip2	C	T	18: 43,582,258	V68I	probably benign	Het
Kif1b	T	G	4: 149,191,255	I1400L	probably damaging	Het
Kif2b	C	T	11: 91,576,227	C410Y	probably benign	Het
Klk1b16	T	C	7: 44,140,765	L153P	possibly damaging	Het
Kndc1	C	T	7: 139,927,795	S1222F	possibly damaging	Het
Lama5	A	G	2: 180,196,518	C855R	probably damaging	Het
Mast3	A	G	8: 70,781,260	L947P	probably damaging	Het
Mblac2	C	A	13: 81,711,953	A142E	possibly damaging	Het
Mppe1	A	G	18: 67,225,854	S348P	possibly damaging	Het
Mroh8	A	C	2: 157,217,019	V909G	probably damaging	Het
Mthfd1	C	T	12: 76,303,980	T712M	probably benign	Het
Nlrp4b	C	T	7: 10,714,959	T363I	probably damaging	Het
Nol10	A	G	12: 17,358,133	E120G	probably damaging	Het
Olfml1	T	C	7: 107,590,216	S163P	probably damaging	Het
Olfr1104	T	C	2: 87,021,897	T216A	probably benign	Het
Olfr135	A	T	17: 38,208,664	N140Y	probably benign	Het
Olfr522	T	C	7: 140,162,285	I222V	probably damaging	Het
Olfr576	A	T	7: 102,965,411	I104F	probably damaging	Het
Olfr902	T	A	9: 38,448,875	M1K	probably null	Het
Pde6a	T	A	18: 61,285,989	L812Q	probably damaging	Het
Pdxp	T	A	15: 78,918,259	M231K	probably damaging	Het
Pi4ka	A	G	16: 17,299,453	L1368P		Het
Ppie	T	C	4: 123,130,551	N171S	possibly damaging	Het
Rimbp2	T	C	5: 128,788,292	H657R	probably benign	Het
Sarnp	T	A	10: 128,821,973		probably null	Het
Serpinb9c	T	C	13: 33,150,346	T266A	probably damaging	Het
Srgap3	T	A	6: 112,780,893	I218F	possibly damaging	Het
Susd1	C	A	4: 59,324,882	W717L	probably benign	Het
Tgfbi	A	G	13: 56,623,589	Y88C	probably damaging	Het
Tmc6	A	T	11: 117,770,482	F624Y	probably damaging	Het
Tnni2	A	G	7: 142,444,276	E172G	probably damaging	Het
Traf3ip1	T	C	1: 91,505,456	S316P	probably benign	Het
Tshr	C	A	12: 91,537,774	N495K	possibly damaging	Het
Ulk3	C	A	9: 57,593,259	A317E	probably damaging	Het
Usp24	T	C	4: 106,418,215	V2229A	possibly damaging	Het
Usp32	G	A	11: 85,053,951	R304C	probably damaging	Het
Usp40	C	T	1: 88,007,341	G28D	probably benign	Het
Vmn1r41	A	G	6: 89,747,127	K217E	possibly damaging	Het
Vmn2r73	T	A	7: 85,858,076	K676M	probably benign	Het
Vnn1	A	G	10: 23,899,451	T200A	possibly damaging	Het
Zc3hav1	A	G	6: 38,325,241	L698P	possibly damaging	Het

Other mutations in Nek10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Nek10	APN	14	14850957	missense	probably damaging	0.99
IGL02067:Nek10	APN	14	14861639	missense	probably benign	0.12
IGL02361:Nek10	APN	14	14843856	missense	probably damaging	1.00
IGL02687:Nek10	APN	14	14840570	missense	probably damaging	1.00
IGL02929:Nek10	APN	14	14821119	missense	possibly damaging	0.82
IGL03229:Nek10	APN	14	14986686	missense	probably benign	0.10
P0041:Nek10	UTSW	14	14861603	missense	probably benign	0.01
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0142:Nek10	UTSW	14	14861560	missense	possibly damaging	0.96
R0433:Nek10	UTSW	14	14860927	missense	probably benign	0.32
R0633:Nek10	UTSW	14	14857782	critical splice acceptor site	probably null
R1087:Nek10	UTSW	14	14827059	missense	possibly damaging	0.59
R1184:Nek10	UTSW	14	14931325	splice site	probably benign
R1250:Nek10	UTSW	14	14853887	missense	probably damaging	1.00
R1371:Nek10	UTSW	14	14850983	missense	probably damaging	0.98
R1506:Nek10	UTSW	14	14999078	splice site	probably benign
R1829:Nek10	UTSW	14	14863454	critical splice acceptor site	probably null
R1831:Nek10	UTSW	14	14842789	missense	probably benign
R1833:Nek10	UTSW	14	14842789	missense	probably benign
R1990:Nek10	UTSW	14	14860764	missense	probably benign
R1997:Nek10	UTSW	14	14827003	missense	probably benign	0.09
R2011:Nek10	UTSW	14	14885122	missense	probably damaging	1.00
R2158:Nek10	UTSW	14	14885047	splice site	probably null
R2288:Nek10	UTSW	14	14853956	nonsense	probably null
R2568:Nek10	UTSW	14	14999112	missense	possibly damaging	0.89
R2907:Nek10	UTSW	14	14980613	missense	possibly damaging	0.81
R2965:Nek10	UTSW	14	14836202	missense	probably damaging	1.00
R3922:Nek10	UTSW	14	14861585	missense	possibly damaging	0.88
R4032:Nek10	UTSW	14	14853877	splice site	probably null
R4700:Nek10	UTSW	14	14842841	missense	possibly damaging	0.69
R4742:Nek10	UTSW	14	14861624	missense	probably null	0.03
R4785:Nek10	UTSW	14	14855714	missense	probably benign
R4890:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4891:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4920:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4924:Nek10	UTSW	14	14846594	splice site	probably null
R4928:Nek10	UTSW	14	14930577	missense	probably damaging	1.00
R4948:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4952:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4953:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R5092:Nek10	UTSW	14	14820851	missense	possibly damaging	0.81
R5097:Nek10	UTSW	14	14857851	missense	probably benign	0.00
R5593:Nek10	UTSW	14	14980544	nonsense	probably null
R5696:Nek10	UTSW	14	14860736	splice site	probably null
R5813:Nek10	UTSW	14	14986704	missense	probably benign	0.01
R5829:Nek10	UTSW	14	14865404	missense	probably damaging	1.00
R5872:Nek10	UTSW	14	14850896	missense	probably benign	0.06
R5939:Nek10	UTSW	14	14931290	missense	possibly damaging	0.58
R6025:Nek10	UTSW	14	14865633	missense	probably benign	0.41
R6235:Nek10	UTSW	14	14821113	nonsense	probably null
R6539:Nek10	UTSW	14	14860789	missense	possibly damaging	0.94
R6542:Nek10	UTSW	14	14999108	missense	probably benign	0.44
R6561:Nek10	UTSW	14	14828448	missense	possibly damaging	0.48
R6659:Nek10	UTSW	14	14861684	missense	probably benign	0.29
R7039:Nek10	UTSW	14	14826946	missense	possibly damaging	0.63
R7039:Nek10	UTSW	14	14986700	missense	probably damaging	0.99
R7102:Nek10	UTSW	14	14828517	missense	probably damaging	1.00
R7185:Nek10	UTSW	14	14846621	missense	probably benign	0.03
R7198:Nek10	UTSW	14	14850947	missense	probably damaging	0.99
R7202:Nek10	UTSW	14	14836171	missense	probably benign	0.01
R7251:Nek10	UTSW	14	14853965	missense	probably benign
R7345:Nek10	UTSW	14	14955503	missense	probably benign
R7590:Nek10	UTSW	14	15006693	makesense	probably null
R7593:Nek10	UTSW	14	14826955	missense	probably benign	0.04
R7616:Nek10	UTSW	14	14937759	missense	probably benign	0.27
R7635:Nek10	UTSW	14	14850932	missense	probably benign	0.01
R7817:Nek10	UTSW	14	15001017	missense	probably benign	0.00
R7826:Nek10	UTSW	14	14860846	splice site	probably null
R7986:Nek10	UTSW	14	15001020	missense	probably benign	0.17
R8765:Nek10	UTSW	14	14999104	missense	probably damaging	0.97
R8856:Nek10	UTSW	14	14937610	missense	probably damaging	0.96
R8973:Nek10	UTSW	14	14931321	critical splice donor site	probably null
R9088:Nek10	UTSW	14	14931314	missense	probably damaging	1.00
R9195:Nek10	UTSW	14	14821139	missense	probably benign	0.03
R9464:Nek10	UTSW	14	14937766	missense	probably benign
R9511:Nek10	UTSW	14	14828511	missense	probably benign	0.05
R9529:Nek10	UTSW	14	14850833	missense	probably benign
R9590:Nek10	UTSW	14	14853888	missense	probably damaging	1.00
Z1177:Nek10	UTSW	14	14853948	missense	probably benign	0.00
Z1177:Nek10	UTSW	14	15001157	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATTGTCTCGTCCGTGAGATG -3'
(R):5'- AGAAGCAACCCAGCTCTGTC -3'

Sequencing Primer
(F):5'- GAGATGAGATTTTGGCTTCCTTCTCC -3'
(R):5'- CTGGACTGATTTACTTCTAGGCAAC -3'

Posted On

2021-10-11