Incidental Mutation 'R9002:Ank'
ID 685058
Institutional Source Beutler Lab
Gene Symbol Ank
Ensembl Gene ENSMUSG00000022265
Gene Name progressive ankylosis
Synonyms D15Ertd221e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 27466677-27594909 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 27544327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 58 (L58*)
Ref Sequence ENSEMBL: ENSMUSP00000022875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022875] [ENSMUST00000228179]
AlphaFold Q9JHZ2
Predicted Effect probably null
Transcript: ENSMUST00000022875
AA Change: L58*
SMART Domains Protein: ENSMUSP00000022875
Gene: ENSMUSG00000022265
AA Change: L58*

DomainStartEndE-ValueType
Pfam:ANKH 1 345 1e-223 PFAM
transmembrane domain 361 383 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228179
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that is expressed in joints and other tissues and controls pyrophosphate levels in cultured cells. Progressive ankylosis-mediated control of pyrophosphate levels has been suggested as a possible mechanism regulating tissue calcification and susceptibility to arthritis in higher animals. Mutations in this gene have been associated with autosomal dominant craniometaphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit joint stiffness due to increased calcium deposits in calcified cartilages and die prematurely. Hyperostosis of craniofacial bones and the mandible has been reported in other mutants as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,926 M1263K possibly damaging Het
Abca8b C T 11: 109,952,630 D985N probably benign Het
Ak5 A T 3: 152,653,454 M207K probably damaging Het
Akt1 T C 12: 112,659,614 I75V probably benign Het
Ap1g1 A C 8: 109,855,106 T666P probably benign Het
Ap3b2 A T 7: 81,467,444 S615T probably benign Het
Ash1l G T 3: 88,981,408 R198L probably benign Het
Axl A T 7: 25,778,678 C199S probably damaging Het
C1d T C 11: 17,262,787 L44S probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col4a4 A G 1: 82,471,311 L1186P probably benign Het
Ctdsp2 T A 10: 126,996,192 I223N probably damaging Het
Eml1 T A 12: 108,538,179 I799N probably damaging Het
Fbxw18 G A 9: 109,690,592 T282I probably damaging Het
Fmo2 A T 1: 162,878,078 C397* probably null Het
Gbp10 C A 5: 105,221,981 V262L probably benign Het
Gm11639 A T 11: 105,029,996 D4671V probably damaging Het
Gm45871 A T 18: 90,591,844 H402L probably damaging Het
Has1 T C 17: 17,843,650 S576G unknown Het
Hat1 C T 2: 71,441,303 R407W probably damaging Het
Hivep2 G T 10: 14,132,413 R1585L probably benign Het
Ifi211 A G 1: 173,906,328 V89A possibly damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Irf9 T A 14: 55,607,683 N333K possibly damaging Het
Jakmip2 C T 18: 43,582,258 V68I probably benign Het
Kif1b T G 4: 149,191,255 I1400L probably damaging Het
Kif2b C T 11: 91,576,227 C410Y probably benign Het
Klk1b16 T C 7: 44,140,765 L153P possibly damaging Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lama5 A G 2: 180,196,518 C855R probably damaging Het
Mast3 A G 8: 70,781,260 L947P probably damaging Het
Mblac2 C A 13: 81,711,953 A142E possibly damaging Het
Mppe1 A G 18: 67,225,854 S348P possibly damaging Het
Mroh8 A C 2: 157,217,019 V909G probably damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nek10 T C 14: 14,980,590 L982P probably damaging Het
Nlrp4b C T 7: 10,714,959 T363I probably damaging Het
Nol10 A G 12: 17,358,133 E120G probably damaging Het
Olfml1 T C 7: 107,590,216 S163P probably damaging Het
Olfr1104 T C 2: 87,021,897 T216A probably benign Het
Olfr135 A T 17: 38,208,664 N140Y probably benign Het
Olfr522 T C 7: 140,162,285 I222V probably damaging Het
Olfr576 A T 7: 102,965,411 I104F probably damaging Het
Olfr902 T A 9: 38,448,875 M1K probably null Het
Pde6a T A 18: 61,285,989 L812Q probably damaging Het
Pdxp T A 15: 78,918,259 M231K probably damaging Het
Pi4ka A G 16: 17,299,453 L1368P Het
Ppie T C 4: 123,130,551 N171S possibly damaging Het
Rimbp2 T C 5: 128,788,292 H657R probably benign Het
Sarnp T A 10: 128,821,973 probably null Het
Serpinb9c T C 13: 33,150,346 T266A probably damaging Het
Srgap3 T A 6: 112,780,893 I218F possibly damaging Het
Susd1 C A 4: 59,324,882 W717L probably benign Het
Tgfbi A G 13: 56,623,589 Y88C probably damaging Het
Tmc6 A T 11: 117,770,482 F624Y probably damaging Het
Tnni2 A G 7: 142,444,276 E172G probably damaging Het
Traf3ip1 T C 1: 91,505,456 S316P probably benign Het
Tshr C A 12: 91,537,774 N495K possibly damaging Het
Ulk3 C A 9: 57,593,259 A317E probably damaging Het
Usp24 T C 4: 106,418,215 V2229A possibly damaging Het
Usp32 G A 11: 85,053,951 R304C probably damaging Het
Usp40 C T 1: 88,007,341 G28D probably benign Het
Vmn1r41 A G 6: 89,747,127 K217E possibly damaging Het
Vmn2r73 T A 7: 85,858,076 K676M probably benign Het
Vnn1 A G 10: 23,899,451 T200A possibly damaging Het
Zc3hav1 A G 6: 38,325,241 L698P possibly damaging Het
Other mutations in Ank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ank APN 15 27544351 missense possibly damaging 0.53
IGL02975:Ank APN 15 27467001 utr 5 prime probably benign
R0309:Ank UTSW 15 27567572 missense possibly damaging 0.65
R0470:Ank UTSW 15 27571635 missense probably damaging 0.98
R1688:Ank UTSW 15 27557234 missense probably damaging 1.00
R1691:Ank UTSW 15 27590944 missense probably damaging 1.00
R2073:Ank UTSW 15 27565022 missense probably benign 0.20
R2248:Ank UTSW 15 27562711 splice site probably null
R3113:Ank UTSW 15 27571614 missense probably damaging 1.00
R4027:Ank UTSW 15 27544257 missense probably damaging 1.00
R4028:Ank UTSW 15 27544257 missense probably damaging 1.00
R4029:Ank UTSW 15 27544257 missense probably damaging 1.00
R4030:Ank UTSW 15 27544257 missense probably damaging 1.00
R4124:Ank UTSW 15 27571623 missense probably damaging 1.00
R4126:Ank UTSW 15 27590373 missense probably benign
R4508:Ank UTSW 15 27564977 missense probably damaging 1.00
R4517:Ank UTSW 15 27562749 missense possibly damaging 0.51
R4631:Ank UTSW 15 27467090 missense probably benign
R4653:Ank UTSW 15 27590361 missense probably null 0.98
R5001:Ank UTSW 15 27562733 missense probably damaging 0.99
R5029:Ank UTSW 15 27590353 missense probably benign 0.00
R5475:Ank UTSW 15 27557199 missense probably damaging 1.00
R7218:Ank UTSW 15 27544321 missense probably damaging 1.00
R7234:Ank UTSW 15 27571656 critical splice donor site probably null
R8530:Ank UTSW 15 27544404 missense probably benign
R8859:Ank UTSW 15 27562748 missense possibly damaging 0.93
R8935:Ank UTSW 15 27591026 missense probably damaging 0.99
R9408:Ank UTSW 15 27591502 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATTCACTCCGCACACTG -3'
(R):5'- TGAAGACGCCACTTAGCCTAC -3'

Sequencing Primer
(F):5'- ACTCCGCACACTGCCTGC -3'
(R):5'- TGAAACGACCAAACCGAAATGCTG -3'
Posted On 2021-10-11