Incidental Mutation 'R9002:Pi4ka'
ID 685060
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Name phosphatidylinositol 4-kinase alpha
Synonyms Pik4ca
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 17280351-17406314 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17299453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1368 (L1368P)
Ref Sequence ENSEMBL: ENSMUSP00000036162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000232232]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: L1368P

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231683
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,926 M1263K possibly damaging Het
Abca8b C T 11: 109,952,630 D985N probably benign Het
Ak5 A T 3: 152,653,454 M207K probably damaging Het
Akt1 T C 12: 112,659,614 I75V probably benign Het
Ank T A 15: 27,544,327 L58* probably null Het
Ap1g1 A C 8: 109,855,106 T666P probably benign Het
Ap3b2 A T 7: 81,467,444 S615T probably benign Het
Ash1l G T 3: 88,981,408 R198L probably benign Het
Axl A T 7: 25,778,678 C199S probably damaging Het
C1d T C 11: 17,262,787 L44S probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col4a4 A G 1: 82,471,311 L1186P probably benign Het
Ctdsp2 T A 10: 126,996,192 I223N probably damaging Het
Eml1 T A 12: 108,538,179 I799N probably damaging Het
Fbxw18 G A 9: 109,690,592 T282I probably damaging Het
Fmo2 A T 1: 162,878,078 C397* probably null Het
Gbp10 C A 5: 105,221,981 V262L probably benign Het
Gm11639 A T 11: 105,029,996 D4671V probably damaging Het
Gm45871 A T 18: 90,591,844 H402L probably damaging Het
Has1 T C 17: 17,843,650 S576G unknown Het
Hat1 C T 2: 71,441,303 R407W probably damaging Het
Hivep2 G T 10: 14,132,413 R1585L probably benign Het
Ifi211 A G 1: 173,906,328 V89A possibly damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Irf9 T A 14: 55,607,683 N333K possibly damaging Het
Jakmip2 C T 18: 43,582,258 V68I probably benign Het
Kif1b T G 4: 149,191,255 I1400L probably damaging Het
Kif2b C T 11: 91,576,227 C410Y probably benign Het
Klk1b16 T C 7: 44,140,765 L153P possibly damaging Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lama5 A G 2: 180,196,518 C855R probably damaging Het
Mast3 A G 8: 70,781,260 L947P probably damaging Het
Mblac2 C A 13: 81,711,953 A142E possibly damaging Het
Mppe1 A G 18: 67,225,854 S348P possibly damaging Het
Mroh8 A C 2: 157,217,019 V909G probably damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nek10 T C 14: 14,980,590 L982P probably damaging Het
Nlrp4b C T 7: 10,714,959 T363I probably damaging Het
Nol10 A G 12: 17,358,133 E120G probably damaging Het
Olfml1 T C 7: 107,590,216 S163P probably damaging Het
Olfr1104 T C 2: 87,021,897 T216A probably benign Het
Olfr135 A T 17: 38,208,664 N140Y probably benign Het
Olfr522 T C 7: 140,162,285 I222V probably damaging Het
Olfr576 A T 7: 102,965,411 I104F probably damaging Het
Olfr902 T A 9: 38,448,875 M1K probably null Het
Pde6a T A 18: 61,285,989 L812Q probably damaging Het
Pdxp T A 15: 78,918,259 M231K probably damaging Het
Ppie T C 4: 123,130,551 N171S possibly damaging Het
Rimbp2 T C 5: 128,788,292 H657R probably benign Het
Sarnp T A 10: 128,821,973 probably null Het
Serpinb9c T C 13: 33,150,346 T266A probably damaging Het
Srgap3 T A 6: 112,780,893 I218F possibly damaging Het
Susd1 C A 4: 59,324,882 W717L probably benign Het
Tgfbi A G 13: 56,623,589 Y88C probably damaging Het
Tmc6 A T 11: 117,770,482 F624Y probably damaging Het
Tnni2 A G 7: 142,444,276 E172G probably damaging Het
Traf3ip1 T C 1: 91,505,456 S316P probably benign Het
Tshr C A 12: 91,537,774 N495K possibly damaging Het
Ulk3 C A 9: 57,593,259 A317E probably damaging Het
Usp24 T C 4: 106,418,215 V2229A possibly damaging Het
Usp32 G A 11: 85,053,951 R304C probably damaging Het
Usp40 C T 1: 88,007,341 G28D probably benign Het
Vmn1r41 A G 6: 89,747,127 K217E possibly damaging Het
Vmn2r73 T A 7: 85,858,076 K676M probably benign Het
Vnn1 A G 10: 23,899,451 T200A possibly damaging Het
Zc3hav1 A G 6: 38,325,241 L698P possibly damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
dove_bar UTSW 16 17326052 splice site probably null
mia UTSW 16 17376982 missense possibly damaging 0.89
Pia UTSW 16 17281044 missense probably damaging 1.00
G1patch:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
R7581:Pi4ka UTSW 16 17301060 missense
R7622:Pi4ka UTSW 16 17293977 missense
R7717:Pi4ka UTSW 16 17376923 missense
R8048:Pi4ka UTSW 16 17303127 missense
R8052:Pi4ka UTSW 16 17356166 missense
R8079:Pi4ka UTSW 16 17303060 missense
R8123:Pi4ka UTSW 16 17281092 missense
R8211:Pi4ka UTSW 16 17282905 missense
R8310:Pi4ka UTSW 16 17354048 critical splice donor site probably null
R8322:Pi4ka UTSW 16 17357573 missense
R8509:Pi4ka UTSW 16 17354144 missense
R8735:Pi4ka UTSW 16 17318370 missense
R8912:Pi4ka UTSW 16 17389366 missense
R8917:Pi4ka UTSW 16 17312446 missense
R8921:Pi4ka UTSW 16 17307740 missense
R8941:Pi4ka UTSW 16 17296943 unclassified probably benign
R9203:Pi4ka UTSW 16 17282301 missense
R9222:Pi4ka UTSW 16 17358361 missense
R9230:Pi4ka UTSW 16 17281924 missense
R9262:Pi4ka UTSW 16 17302995 missense
R9338:Pi4ka UTSW 16 17317363 missense
R9374:Pi4ka UTSW 16 17307710 missense
R9436:Pi4ka UTSW 16 17307806 missense
R9499:Pi4ka UTSW 16 17307710 missense
R9501:Pi4ka UTSW 16 17386292 missense
R9551:Pi4ka UTSW 16 17307710 missense
R9705:Pi4ka UTSW 16 17281951 missense
RF007:Pi4ka UTSW 16 17297233 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATCCAGTGTAGGTTGGAGG -3'
(R):5'- TCAGCTCTCATTGCTTTGTGAATAG -3'

Sequencing Primer
(F):5'- AACAGGCAAGCAAGTACTGAGTTTTC -3'
(R):5'- GAATAGTTTCTAGTCTCTGACTCCAG -3'
Posted On 2021-10-11