Incidental Mutation 'R9002:Mppe1'
ID 685065
Institutional Source Beutler Lab
Gene Symbol Mppe1
Ensembl Gene ENSMUSG00000062526
Gene Name metallophosphoesterase 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67225530-67245830 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67225854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 348 (S348P)
Ref Sequence ENSEMBL: ENSMUSP00000072808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025402] [ENSMUST00000073054] [ENSMUST00000076605]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025402
SMART Domains Protein: ENSMUSP00000025402
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
G_alpha 89 447 1.18e-172 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073054
AA Change: S348P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072808
Gene: ENSMUSG00000062526
AA Change: S348P

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Metallophos 68 308 3.3e-13 PFAM
transmembrane domain 358 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076605
SMART Domains Protein: ENSMUSP00000075908
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
G_alpha 22 380 5.02e-176 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,926 M1263K possibly damaging Het
Abca8b C T 11: 109,952,630 D985N probably benign Het
Ak5 A T 3: 152,653,454 M207K probably damaging Het
Akt1 T C 12: 112,659,614 I75V probably benign Het
Ank T A 15: 27,544,327 L58* probably null Het
Ap1g1 A C 8: 109,855,106 T666P probably benign Het
Ap3b2 A T 7: 81,467,444 S615T probably benign Het
Ash1l G T 3: 88,981,408 R198L probably benign Het
Axl A T 7: 25,778,678 C199S probably damaging Het
C1d T C 11: 17,262,787 L44S probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col4a4 A G 1: 82,471,311 L1186P probably benign Het
Ctdsp2 T A 10: 126,996,192 I223N probably damaging Het
Eml1 T A 12: 108,538,179 I799N probably damaging Het
Fbxw18 G A 9: 109,690,592 T282I probably damaging Het
Fmo2 A T 1: 162,878,078 C397* probably null Het
Gbp10 C A 5: 105,221,981 V262L probably benign Het
Gm11639 A T 11: 105,029,996 D4671V probably damaging Het
Gm45871 A T 18: 90,591,844 H402L probably damaging Het
Has1 T C 17: 17,843,650 S576G unknown Het
Hat1 C T 2: 71,441,303 R407W probably damaging Het
Hivep2 G T 10: 14,132,413 R1585L probably benign Het
Ifi211 A G 1: 173,906,328 V89A possibly damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Irf9 T A 14: 55,607,683 N333K possibly damaging Het
Jakmip2 C T 18: 43,582,258 V68I probably benign Het
Kif1b T G 4: 149,191,255 I1400L probably damaging Het
Kif2b C T 11: 91,576,227 C410Y probably benign Het
Klk1b16 T C 7: 44,140,765 L153P possibly damaging Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lama5 A G 2: 180,196,518 C855R probably damaging Het
Mast3 A G 8: 70,781,260 L947P probably damaging Het
Mblac2 C A 13: 81,711,953 A142E possibly damaging Het
Mroh8 A C 2: 157,217,019 V909G probably damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nek10 T C 14: 14,980,590 L982P probably damaging Het
Nlrp4b C T 7: 10,714,959 T363I probably damaging Het
Nol10 A G 12: 17,358,133 E120G probably damaging Het
Olfml1 T C 7: 107,590,216 S163P probably damaging Het
Olfr1104 T C 2: 87,021,897 T216A probably benign Het
Olfr135 A T 17: 38,208,664 N140Y probably benign Het
Olfr522 T C 7: 140,162,285 I222V probably damaging Het
Olfr576 A T 7: 102,965,411 I104F probably damaging Het
Olfr902 T A 9: 38,448,875 M1K probably null Het
Pde6a T A 18: 61,285,989 L812Q probably damaging Het
Pdxp T A 15: 78,918,259 M231K probably damaging Het
Pi4ka A G 16: 17,299,453 L1368P Het
Ppie T C 4: 123,130,551 N171S possibly damaging Het
Rimbp2 T C 5: 128,788,292 H657R probably benign Het
Sarnp T A 10: 128,821,973 probably null Het
Serpinb9c T C 13: 33,150,346 T266A probably damaging Het
Srgap3 T A 6: 112,780,893 I218F possibly damaging Het
Susd1 C A 4: 59,324,882 W717L probably benign Het
Tgfbi A G 13: 56,623,589 Y88C probably damaging Het
Tmc6 A T 11: 117,770,482 F624Y probably damaging Het
Tnni2 A G 7: 142,444,276 E172G probably damaging Het
Traf3ip1 T C 1: 91,505,456 S316P probably benign Het
Tshr C A 12: 91,537,774 N495K possibly damaging Het
Ulk3 C A 9: 57,593,259 A317E probably damaging Het
Usp24 T C 4: 106,418,215 V2229A possibly damaging Het
Usp32 G A 11: 85,053,951 R304C probably damaging Het
Usp40 C T 1: 88,007,341 G28D probably benign Het
Vmn1r41 A G 6: 89,747,127 K217E possibly damaging Het
Vmn2r73 T A 7: 85,858,076 K676M probably benign Het
Vnn1 A G 10: 23,899,451 T200A possibly damaging Het
Zc3hav1 A G 6: 38,325,241 L698P possibly damaging Het
Other mutations in Mppe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Mppe1 APN 18 67237444 nonsense probably null
IGL03028:Mppe1 APN 18 67227684 missense probably damaging 1.00
R0087:Mppe1 UTSW 18 67225704 makesense probably null
R0538:Mppe1 UTSW 18 67237477 missense probably damaging 1.00
R0552:Mppe1 UTSW 18 67237348 critical splice donor site probably null
R1170:Mppe1 UTSW 18 67227706 missense probably damaging 1.00
R1970:Mppe1 UTSW 18 67229772 missense probably benign 0.07
R2229:Mppe1 UTSW 18 67228011 critical splice donor site probably null
R3874:Mppe1 UTSW 18 67225886 critical splice acceptor site probably null
R4194:Mppe1 UTSW 18 67228068 missense probably benign 0.27
R4775:Mppe1 UTSW 18 67226859 missense possibly damaging 0.96
R4940:Mppe1 UTSW 18 67228024 missense probably damaging 1.00
R4974:Mppe1 UTSW 18 67228062 missense probably benign
R4979:Mppe1 UTSW 18 67229702 missense probably damaging 1.00
R5768:Mppe1 UTSW 18 67225818 missense possibly damaging 0.87
R5784:Mppe1 UTSW 18 67228027 missense probably benign 0.12
R5895:Mppe1 UTSW 18 67225763 missense probably benign 0.00
R6547:Mppe1 UTSW 18 67228988 missense probably benign
R7161:Mppe1 UTSW 18 67229771 missense probably benign 0.10
R7580:Mppe1 UTSW 18 67237417 missense probably damaging 0.99
R7699:Mppe1 UTSW 18 67225704 makesense probably null
R7700:Mppe1 UTSW 18 67225704 makesense probably null
R7908:Mppe1 UTSW 18 67228984 missense probably benign 0.01
R8399:Mppe1 UTSW 18 67225875 missense probably benign 0.17
R8896:Mppe1 UTSW 18 67237401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCACCGGCTCTTCATC -3'
(R):5'- GCATACAAGTCAGCATATCTTTGGC -3'

Sequencing Primer
(F):5'- ATCTCCTCATGTGCAACCTG -3'
(R):5'- AAGTCAGCATATCTTTGGCTTCTTTC -3'
Posted On 2021-10-11