Incidental Mutation 'R9004:Nck2'
ID 685120
Institutional Source Beutler Lab
Gene Symbol Nck2
Ensembl Gene ENSMUSG00000066877
Gene Name non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms 4833426I10Rik, Grb4, NCKbeta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9004 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 43444579-43570515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43554350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 239 (N239I)
Ref Sequence ENSEMBL: ENSMUSP00000083611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086421] [ENSMUST00000202540]
AlphaFold O55033
Predicted Effect
SMART Domains Protein: ENSMUSP00000083611
Gene: ENSMUSG00000066877
AA Change: N239I

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114744
SMART Domains Protein: ENSMUSP00000110392
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202540
SMART Domains Protein: ENSMUSP00000144224
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 4.3e-19 SMART
PDB:2CUB|A 106 142 4e-13 PDB
Blast:SH3 114 142 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,618,335 probably benign Het
2310057N15Rik C A 16: 88,774,098 C18F probably damaging Het
Abca7 T A 10: 80,005,649 M941K probably damaging Het
Abcd2 A G 15: 91,190,848 I254T probably benign Het
Abcg8 C A 17: 84,697,362 T519K probably benign Het
Adcy9 A G 16: 4,288,514 V1149A probably damaging Het
Alg10b A G 15: 90,225,691 Y69C probably damaging Het
Arhgef10l T C 4: 140,552,610 D529G probably damaging Het
Ascc3 T A 10: 50,842,180 C1990S probably benign Het
BC034090 T A 1: 155,226,392 N42I possibly damaging Het
Bptf G A 11: 107,054,887 P2509S probably damaging Het
Carmil1 T A 13: 24,041,679 D1042V probably damaging Het
Ccny A G 18: 9,332,883 V216A possibly damaging Het
Cdr2 T C 7: 120,958,499 N268D probably benign Het
Cep152 T C 2: 125,611,100 S351G probably benign Het
Chrm1 T C 19: 8,678,545 C205R possibly damaging Het
Dalrd3 C A 9: 108,572,231 D454E probably benign Het
Dmbt1 T C 7: 131,112,069 L1622P unknown Het
Eif2s2 A G 2: 154,878,484 Y172H probably benign Het
Ell T A 8: 70,578,954 S101T probably damaging Het
Faf1 A G 4: 109,841,353 T337A probably benign Het
Fhad1 A T 4: 141,922,424 probably benign Het
Gen1 T C 12: 11,255,021 probably benign Het
Gfap A G 11: 102,891,442 I414T probably benign Het
Ginm1 A C 10: 7,775,255 V129G probably damaging Het
Helq C T 5: 100,778,732 probably benign Het
Hoxb3 A G 11: 96,346,311 D405G possibly damaging Het
Hsp90aa1 A G 12: 110,692,611 V584A probably damaging Het
Iglc2 T C 16: 19,198,675 K59R probably benign Het
Inhba T C 13: 16,026,941 S363P probably benign Het
Kif1c A G 11: 70,725,132 K656E probably benign Het
Mroh4 G T 15: 74,614,322 L492I possibly damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Naaladl1 C A 19: 6,105,935 D46E probably damaging Het
Nbea C T 3: 56,002,938 V1279I probably benign Het
Nceh1 T A 3: 27,239,577 D161E possibly damaging Het
Nlrx1 C T 9: 44,256,347 R751H probably benign Het
Olfr1116 T A 2: 87,269,351 F190Y possibly damaging Het
Olfr146 C A 9: 39,019,284 V86L probably benign Het
Olfr910 A G 9: 38,539,234 Y113C probably benign Het
Oscar A T 7: 3,616,041 C13S possibly damaging Het
Pappa2 T A 1: 158,936,409 I511F probably damaging Het
Pappa2 T C 1: 158,936,948 D331G possibly damaging Het
Pde4c C T 8: 70,746,866 S265L possibly damaging Het
Pex1 A G 5: 3,612,914 S502G probably benign Het
Pigl A G 11: 62,512,953 Y237C probably damaging Het
Pkd1 A T 17: 24,580,447 Q2880L probably benign Het
Pkhd1l1 A T 15: 44,543,372 H2335L probably benign Het
Ppp1r17 A G 6: 56,031,528 E151G probably damaging Het
Ppp1r27 A G 11: 120,551,023 Y11H probably damaging Het
Prss54 C A 8: 95,565,509 K147N possibly damaging Het
Ptchd3 T A 11: 121,841,861 F526I possibly damaging Het
Ptprt T C 2: 161,766,394 N661D probably benign Het
Rfpl4b T C 10: 38,821,775 probably benign Het
Sdad1 T C 5: 92,291,961 T402A probably benign Het
Stk32c T C 7: 139,122,943 D178G probably damaging Het
Tas2r119 T C 15: 32,177,963 L225P probably damaging Het
Tdpoz4 A T 3: 93,796,711 E105V probably benign Het
Tlk1 A G 2: 70,721,946 I520T probably damaging Het
Tmf1 A G 6: 97,175,777 V445A probably benign Het
Tomm6 T C 17: 47,687,908 D40G possibly damaging Het
Traf6 C A 2: 101,690,098 Q164K probably benign Het
Tspoap1 A G 11: 87,779,458 H150R Het
Ube2g2 A T 10: 77,643,600 M126L probably benign Het
Unc45b A G 11: 82,928,689 D496G probably damaging Het
Vmn1r74 A C 7: 11,846,913 I47L probably benign Het
Vmn2r88 A T 14: 51,413,167 L112F Het
Wwc2 A C 8: 47,920,697 L45V probably damaging Het
Zfp459 A C 13: 67,408,595 I123R probably damaging Het
Other mutations in Nck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
wake UTSW 1 43554260 missense probably benign
R0420:Nck2 UTSW 1 43554118 missense probably damaging 1.00
R0503:Nck2 UTSW 1 43533568 start codon destroyed probably null 0.96
R0538:Nck2 UTSW 1 43569144 splice site probably benign
R1080:Nck2 UTSW 1 43533581 missense probably benign 0.00
R2509:Nck2 UTSW 1 43554233 missense probably damaging 1.00
R4029:Nck2 UTSW 1 43554091 missense probably benign
R4923:Nck2 UTSW 1 43461071 intron probably benign
R5425:Nck2 UTSW 1 43554392 missense probably benign 0.05
R6175:Nck2 UTSW 1 43533569 start codon destroyed probably null 0.96
R6683:Nck2 UTSW 1 43569178 missense probably benign
R6859:Nck2 UTSW 1 43554351 missense probably benign 0.24
R7514:Nck2 UTSW 1 43569221 missense probably benign 0.00
R8021:Nck2 UTSW 1 43554260 missense probably benign
R8278:Nck2 UTSW 1 43554580 missense probably damaging 1.00
R9063:Nck2 UTSW 1 43554343 missense possibly damaging 0.91
Z1088:Nck2 UTSW 1 43554383 missense possibly damaging 0.55
Z1177:Nck2 UTSW 1 43554356 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACTACGTTTTGGAGGAAGCG -3'
(R):5'- ACTCGCTGTCCCTAATGAGG -3'

Sequencing Primer
(F):5'- TTCCTGAGCCTACGTCGG -3'
(R):5'- TCATTGAGCGCACACTCG -3'
Posted On 2021-10-11