Incidental Mutation 'R9004:Sdad1'
ID 685136
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene Name SDA1 domain containing 1
Synonyms
MMRRC Submission 068834-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R9004 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 92431869-92457883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92439820 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 402 (T402A)
Ref Sequence ENSEMBL: ENSMUSP00000031364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031364
AA Change: T402A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: T402A

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201143
AA Change: T401A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: T401A

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,454,197 (GRCm39) probably benign Het
2310057N15Rik C A 16: 88,570,986 (GRCm39) C18F probably damaging Het
Abca7 T A 10: 79,841,483 (GRCm39) M941K probably damaging Het
Abcd2 A G 15: 91,075,051 (GRCm39) I254T probably benign Het
Abcg8 C A 17: 85,004,790 (GRCm39) T519K probably benign Het
Adcy9 A G 16: 4,106,378 (GRCm39) V1149A probably damaging Het
Alg10b A G 15: 90,109,894 (GRCm39) Y69C probably damaging Het
Arhgef10l T C 4: 140,279,921 (GRCm39) D529G probably damaging Het
Ascc3 T A 10: 50,718,276 (GRCm39) C1990S probably benign Het
BC034090 T A 1: 155,102,138 (GRCm39) N42I possibly damaging Het
Bptf G A 11: 106,945,713 (GRCm39) P2509S probably damaging Het
Carmil1 T A 13: 24,225,662 (GRCm39) D1042V probably damaging Het
Ccny A G 18: 9,332,883 (GRCm39) V216A possibly damaging Het
Cdr2 T C 7: 120,557,722 (GRCm39) N268D probably benign Het
Cep152 T C 2: 125,453,020 (GRCm39) S351G probably benign Het
Chrm1 T C 19: 8,655,909 (GRCm39) C205R possibly damaging Het
Dalrd3 C A 9: 108,449,430 (GRCm39) D454E probably benign Het
Dmbt1 T C 7: 130,713,798 (GRCm39) L1622P unknown Het
Eif2s2 A G 2: 154,720,404 (GRCm39) Y172H probably benign Het
Ell T A 8: 71,031,604 (GRCm39) S101T probably damaging Het
Faf1 A G 4: 109,698,550 (GRCm39) T337A probably benign Het
Fhad1 A T 4: 141,649,735 (GRCm39) probably benign Het
Gen1 T C 12: 11,305,022 (GRCm39) probably benign Het
Gfap A G 11: 102,782,268 (GRCm39) I414T probably benign Het
Ginm1 A C 10: 7,651,019 (GRCm39) V129G probably damaging Het
Helq C T 5: 100,926,598 (GRCm39) probably benign Het
Hoxb3 A G 11: 96,237,137 (GRCm39) D405G possibly damaging Het
Hsp90aa1 A G 12: 110,659,045 (GRCm39) V584A probably damaging Het
Iglc2 T C 16: 19,017,425 (GRCm39) K59R probably benign Het
Inhba T C 13: 16,201,526 (GRCm39) S363P probably benign Het
Kif1c A G 11: 70,615,958 (GRCm39) K656E probably benign Het
Mroh4 G T 15: 74,486,171 (GRCm39) L492I possibly damaging Het
Mthfd1 C T 12: 76,350,754 (GRCm39) T712M probably benign Het
Naaladl1 C A 19: 6,155,965 (GRCm39) D46E probably damaging Het
Nbea C T 3: 55,910,359 (GRCm39) V1279I probably benign Het
Nceh1 T A 3: 27,293,726 (GRCm39) D161E possibly damaging Het
Nck2 A T 1: 43,593,510 (GRCm39) N239I Het
Nlrx1 C T 9: 44,167,644 (GRCm39) R751H probably benign Het
Or10ag54 T A 2: 87,099,695 (GRCm39) F190Y possibly damaging Het
Or8b46 A G 9: 38,450,530 (GRCm39) Y113C probably benign Het
Or8g17 C A 9: 38,930,580 (GRCm39) V86L probably benign Het
Oscar A T 7: 3,619,040 (GRCm39) C13S possibly damaging Het
Pappa2 T A 1: 158,763,979 (GRCm39) I511F probably damaging Het
Pappa2 T C 1: 158,764,518 (GRCm39) D331G possibly damaging Het
Pde4c C T 8: 71,199,515 (GRCm39) S265L possibly damaging Het
Pex1 A G 5: 3,662,914 (GRCm39) S502G probably benign Het
Pigl A G 11: 62,403,779 (GRCm39) Y237C probably damaging Het
Pkd1 A T 17: 24,799,421 (GRCm39) Q2880L probably benign Het
Pkhd1l1 A T 15: 44,406,768 (GRCm39) H2335L probably benign Het
Ppp1r17 A G 6: 56,008,513 (GRCm39) E151G probably damaging Het
Ppp1r27 A G 11: 120,441,849 (GRCm39) Y11H probably damaging Het
Prss54 C A 8: 96,292,137 (GRCm39) K147N possibly damaging Het
Ptchd3 T A 11: 121,732,687 (GRCm39) F526I possibly damaging Het
Ptprt T C 2: 161,608,314 (GRCm39) N661D probably benign Het
Rfpl4b T C 10: 38,697,771 (GRCm39) probably benign Het
Stk32c T C 7: 138,702,859 (GRCm39) D178G probably damaging Het
Tas2r119 T C 15: 32,178,109 (GRCm39) L225P probably damaging Het
Tdpoz4 A T 3: 93,704,018 (GRCm39) E105V probably benign Het
Tlk1 A G 2: 70,552,290 (GRCm39) I520T probably damaging Het
Tmf1 A G 6: 97,152,738 (GRCm39) V445A probably benign Het
Tomm6 T C 17: 47,998,833 (GRCm39) D40G possibly damaging Het
Traf6 C A 2: 101,520,443 (GRCm39) Q164K probably benign Het
Tspoap1 A G 11: 87,670,284 (GRCm39) H150R Het
Ube2g2 A T 10: 77,479,434 (GRCm39) M126L probably benign Het
Unc45b A G 11: 82,819,515 (GRCm39) D496G probably damaging Het
Vmn1r74 A C 7: 11,580,840 (GRCm39) I47L probably benign Het
Vmn2r88 A T 14: 51,650,624 (GRCm39) L112F Het
Wwc2 A C 8: 48,373,732 (GRCm39) L45V probably damaging Het
Zfp459 A C 13: 67,556,714 (GRCm39) I123R probably damaging Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92,451,632 (GRCm39) splice site probably null
IGL01355:Sdad1 APN 5 92,450,538 (GRCm39) missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92,445,019 (GRCm39) missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92,439,621 (GRCm39) missense probably benign 0.03
IGL02503:Sdad1 APN 5 92,449,661 (GRCm39) unclassified probably benign
IGL02739:Sdad1 APN 5 92,437,931 (GRCm39) missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92,439,777 (GRCm39) missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92,452,923 (GRCm39) missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92,446,092 (GRCm39) missense probably benign 0.32
R1496:Sdad1 UTSW 5 92,457,682 (GRCm39) missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92,453,155 (GRCm39) nonsense probably null
R1848:Sdad1 UTSW 5 92,440,510 (GRCm39) critical splice donor site probably null
R2419:Sdad1 UTSW 5 92,453,677 (GRCm39) missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92,447,958 (GRCm39) missense probably benign 0.00
R2509:Sdad1 UTSW 5 92,453,684 (GRCm39) missense probably benign 0.12
R4043:Sdad1 UTSW 5 92,450,553 (GRCm39) missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92,446,116 (GRCm39) missense probably benign 0.01
R4477:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92,452,836 (GRCm39) missense possibly damaging 0.61
R4749:Sdad1 UTSW 5 92,452,836 (GRCm39) missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92,451,793 (GRCm39) missense probably benign 0.00
R5288:Sdad1 UTSW 5 92,434,684 (GRCm39) makesense probably null
R6331:Sdad1 UTSW 5 92,451,789 (GRCm39) missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92,446,049 (GRCm39) critical splice donor site probably null
R7099:Sdad1 UTSW 5 92,441,832 (GRCm39) missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92,453,596 (GRCm39) missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92,447,980 (GRCm39) missense probably benign 0.10
R7714:Sdad1 UTSW 5 92,450,538 (GRCm39) missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92,447,948 (GRCm39) missense probably benign 0.01
R8198:Sdad1 UTSW 5 92,439,811 (GRCm39) missense probably damaging 0.96
R8347:Sdad1 UTSW 5 92,446,088 (GRCm39) missense probably benign 0.00
R8693:Sdad1 UTSW 5 92,452,857 (GRCm39) missense probably benign 0.09
R8696:Sdad1 UTSW 5 92,437,645 (GRCm39) missense probably damaging 1.00
R8746:Sdad1 UTSW 5 92,437,784 (GRCm39) missense probably benign
R9166:Sdad1 UTSW 5 92,446,080 (GRCm39) nonsense probably null
R9732:Sdad1 UTSW 5 92,438,942 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGGTTCAATGTCCGGAAG -3'
(R):5'- CAACTGTCAGAGGAAGTGCAAC -3'

Sequencing Primer
(F):5'- ACATCTAGGAGACACTGCCTTTG -3'
(R):5'- CAACTGTTGGGAATGTCAGTC -3'
Posted On 2021-10-11