Incidental Mutation 'R9004:Hsp90aa1'
ID 685166
Institutional Source Beutler Lab
Gene Symbol Hsp90aa1
Ensembl Gene ENSMUSG00000021270
Gene Name heat shock protein 90, alpha (cytosolic), class A member 1
Synonyms hsp4, Hspca, Hsp90, Hsp86-1, Hsp89
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9004 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 110690605-110702728 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110692611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 584 (V584A)
Ref Sequence ENSEMBL: ENSMUSP00000091921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]
AlphaFold P07901
Predicted Effect probably damaging
Transcript: ENSMUST00000021698
AA Change: V584A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: V584A

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 733 6.7e-272 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094361
AA Change: V584A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: V584A

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 728 2e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124156
SMART Domains Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 103 1e-69 PDB
SCOP:d1byqa_ 11 103 5e-48 SMART
Blast:HATPase_c 40 103 7e-39 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149189
SMART Domains Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 98 6e-66 PDB
SCOP:d1byqa_ 11 98 2e-45 SMART
Blast:HATPase_c 40 98 2e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155242
SMART Domains Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,618,335 probably benign Het
2310057N15Rik C A 16: 88,774,098 C18F probably damaging Het
Abca7 T A 10: 80,005,649 M941K probably damaging Het
Abcd2 A G 15: 91,190,848 I254T probably benign Het
Abcg8 C A 17: 84,697,362 T519K probably benign Het
Adcy9 A G 16: 4,288,514 V1149A probably damaging Het
Alg10b A G 15: 90,225,691 Y69C probably damaging Het
Arhgef10l T C 4: 140,552,610 D529G probably damaging Het
Ascc3 T A 10: 50,842,180 C1990S probably benign Het
BC034090 T A 1: 155,226,392 N42I possibly damaging Het
Bptf G A 11: 107,054,887 P2509S probably damaging Het
Carmil1 T A 13: 24,041,679 D1042V probably damaging Het
Ccny A G 18: 9,332,883 V216A possibly damaging Het
Cdr2 T C 7: 120,958,499 N268D probably benign Het
Cep152 T C 2: 125,611,100 S351G probably benign Het
Chrm1 T C 19: 8,678,545 C205R possibly damaging Het
Dalrd3 C A 9: 108,572,231 D454E probably benign Het
Dmbt1 T C 7: 131,112,069 L1622P unknown Het
Eif2s2 A G 2: 154,878,484 Y172H probably benign Het
Ell T A 8: 70,578,954 S101T probably damaging Het
Faf1 A G 4: 109,841,353 T337A probably benign Het
Fhad1 A T 4: 141,922,424 probably benign Het
Gen1 T C 12: 11,255,021 probably benign Het
Gfap A G 11: 102,891,442 I414T probably benign Het
Ginm1 A C 10: 7,775,255 V129G probably damaging Het
Helq C T 5: 100,778,732 probably benign Het
Hoxb3 A G 11: 96,346,311 D405G possibly damaging Het
Iglc2 T C 16: 19,198,675 K59R probably benign Het
Inhba T C 13: 16,026,941 S363P probably benign Het
Kif1c A G 11: 70,725,132 K656E probably benign Het
Mroh4 G T 15: 74,614,322 L492I possibly damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Naaladl1 C A 19: 6,105,935 D46E probably damaging Het
Nbea C T 3: 56,002,938 V1279I probably benign Het
Nceh1 T A 3: 27,239,577 D161E possibly damaging Het
Nck2 A T 1: 43,554,350 N239I Het
Nlrx1 C T 9: 44,256,347 R751H probably benign Het
Olfr1116 T A 2: 87,269,351 F190Y possibly damaging Het
Olfr146 C A 9: 39,019,284 V86L probably benign Het
Olfr910 A G 9: 38,539,234 Y113C probably benign Het
Oscar A T 7: 3,616,041 C13S possibly damaging Het
Pappa2 T A 1: 158,936,409 I511F probably damaging Het
Pappa2 T C 1: 158,936,948 D331G possibly damaging Het
Pde4c C T 8: 70,746,866 S265L possibly damaging Het
Pex1 A G 5: 3,612,914 S502G probably benign Het
Pigl A G 11: 62,512,953 Y237C probably damaging Het
Pkd1 A T 17: 24,580,447 Q2880L probably benign Het
Pkhd1l1 A T 15: 44,543,372 H2335L probably benign Het
Ppp1r17 A G 6: 56,031,528 E151G probably damaging Het
Ppp1r27 A G 11: 120,551,023 Y11H probably damaging Het
Prss54 C A 8: 95,565,509 K147N possibly damaging Het
Ptchd3 T A 11: 121,841,861 F526I possibly damaging Het
Ptprt T C 2: 161,766,394 N661D probably benign Het
Rfpl4b T C 10: 38,821,775 probably benign Het
Sdad1 T C 5: 92,291,961 T402A probably benign Het
Stk32c T C 7: 139,122,943 D178G probably damaging Het
Tas2r119 T C 15: 32,177,963 L225P probably damaging Het
Tdpoz4 A T 3: 93,796,711 E105V probably benign Het
Tlk1 A G 2: 70,721,946 I520T probably damaging Het
Tmf1 A G 6: 97,175,777 V445A probably benign Het
Tomm6 T C 17: 47,687,908 D40G possibly damaging Het
Traf6 C A 2: 101,690,098 Q164K probably benign Het
Tspoap1 A G 11: 87,779,458 H150R Het
Ube2g2 A T 10: 77,643,600 M126L probably benign Het
Unc45b A G 11: 82,928,689 D496G probably damaging Het
Vmn1r74 A C 7: 11,846,913 I47L probably benign Het
Vmn2r88 A T 14: 51,413,167 L112F Het
Wwc2 A C 8: 47,920,697 L45V probably damaging Het
Zfp459 A C 13: 67,408,595 I123R probably damaging Het
Other mutations in Hsp90aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Hsp90aa1 APN 12 110694015 unclassified probably benign
IGL02243:Hsp90aa1 APN 12 110695091 missense probably damaging 1.00
IGL02865:Hsp90aa1 APN 12 110693082 missense probably benign 0.11
IGL02965:Hsp90aa1 APN 12 110695679 start codon destroyed probably null 0.95
R0827:Hsp90aa1 UTSW 12 110692695 missense probably benign 0.38
R1331:Hsp90aa1 UTSW 12 110692820 missense probably damaging 1.00
R1498:Hsp90aa1 UTSW 12 110695688 splice site probably null
R2039:Hsp90aa1 UTSW 12 110693782 missense probably damaging 1.00
R2082:Hsp90aa1 UTSW 12 110692827 missense probably damaging 1.00
R2102:Hsp90aa1 UTSW 12 110694132 missense probably damaging 0.99
R2169:Hsp90aa1 UTSW 12 110692734 missense probably damaging 0.99
R2194:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2194:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2359:Hsp90aa1 UTSW 12 110694569 critical splice donor site probably null
R2364:Hsp90aa1 UTSW 12 110692753 missense probably damaging 0.99
R2393:Hsp90aa1 UTSW 12 110693406 missense probably damaging 1.00
R2398:Hsp90aa1 UTSW 12 110692321 missense possibly damaging 0.86
R2435:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2435:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2924:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2924:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2925:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2925:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3176:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3176:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3177:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3177:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3276:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3276:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3277:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3277:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3615:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3615:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3616:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3616:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4033:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R4033:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4815:Hsp90aa1 UTSW 12 110695226 missense possibly damaging 0.45
R4932:Hsp90aa1 UTSW 12 110693717 missense probably damaging 1.00
R5117:Hsp90aa1 UTSW 12 110695264 missense possibly damaging 0.71
R5555:Hsp90aa1 UTSW 12 110692734 missense probably damaging 1.00
R6382:Hsp90aa1 UTSW 12 110695517 critical splice donor site probably null
R7024:Hsp90aa1 UTSW 12 110694112 missense possibly damaging 0.46
R7324:Hsp90aa1 UTSW 12 110695225 missense unknown
R7447:Hsp90aa1 UTSW 12 110692128 missense possibly damaging 0.94
R7526:Hsp90aa1 UTSW 12 110695294 missense unknown
R7732:Hsp90aa1 UTSW 12 110693418 missense probably damaging 1.00
R8155:Hsp90aa1 UTSW 12 110695394 missense unknown
R9145:Hsp90aa1 UTSW 12 110696250 critical splice donor site probably null
Z1177:Hsp90aa1 UTSW 12 110693466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCCATATGTGCTTGTGAC -3'
(R):5'- TGATGAGTATTGTGTGCAACAGC -3'

Sequencing Primer
(F):5'- TGTGCTTGTGACAATACAGCACG -3'
(R):5'- TATTGTGTGCAACAGCTGAAG -3'
Posted On 2021-10-11