Incidental Mutation 'R9005:Cyp24a1'
ID 685194
Institutional Source Beutler Lab
Gene Symbol Cyp24a1
Ensembl Gene ENSMUSG00000038567
Gene Name cytochrome P450, family 24, subfamily a, polypeptide 1
Synonyms Cyp24, 25-hydroxyvitamin D-24-hydroxylase, CP24, 24-OHase
MMRRC Submission 068835-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 170324877-170339065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 170336005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 211 (S211T)
Ref Sequence ENSEMBL: ENSMUSP00000047954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038824] [ENSMUST00000075087]
AlphaFold Q64441
Predicted Effect probably damaging
Transcript: ENSMUST00000038824
AA Change: S211T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047954
Gene: ENSMUSG00000038567
AA Change: S211T

DomainStartEndE-ValueType
Pfam:p450 58 511 6e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075087
SMART Domains Protein: ENSMUSP00000074596
Gene: ENSMUSG00000052033

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 69 1.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The protein encoded by this gene localizes to the mitochondrion, where it degrades calcitriol to calcitetrol. This gene is upregulated by binding of calcitriol to the upstream regulatory region and to a downstream enhancer region, thereby allowing calcitriol to autoregulate its concentration in the cell. The encoded protein may also play a role in calcium homeostasis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene suffer a 50% mortality rate between birth and weaning. abnormalities are seen in the development of membranous bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,630,075 (GRCm39) probably benign Het
Abcd4 C T 12: 84,655,356 (GRCm39) W369* probably null Het
Abcf3 A G 16: 20,368,056 (GRCm39) E98G probably benign Het
Acaca A T 11: 84,262,410 (GRCm39) D2004V probably damaging Het
Acot5 G C 12: 84,116,630 (GRCm39) M130I Het
Adamts3 C T 5: 89,825,693 (GRCm39) E1049K probably benign Het
Agfg2 A T 5: 137,650,744 (GRCm39) L456Q probably damaging Het
Agtr1b T A 3: 20,370,343 (GRCm39) T88S possibly damaging Het
Amer2 G C 14: 60,617,376 (GRCm39) D524H probably damaging Het
Ankrd61 T A 5: 143,831,676 (GRCm39) T43S probably benign Het
Apcs A G 1: 172,721,776 (GRCm39) L190P probably benign Het
Arsg A G 11: 109,381,346 (GRCm39) K30E probably benign Het
Banp A T 8: 122,705,441 (GRCm39) M104L possibly damaging Het
Caskin1 A G 17: 24,718,111 (GRCm39) Q268R probably benign Het
Ccdc112 A G 18: 46,429,455 (GRCm39) V81A probably damaging Het
Cfap44 T C 16: 44,280,517 (GRCm39) I1432T probably damaging Het
Chd2 A T 7: 73,134,294 (GRCm39) N684K probably damaging Het
Creb1 T C 1: 64,605,478 (GRCm39) probably null Het
Ctsc C T 7: 87,927,502 (GRCm39) T31I probably damaging Het
Cttnbp2 C A 6: 18,434,430 (GRCm39) R476L probably damaging Het
Cwf19l1 T C 19: 44,111,653 (GRCm39) D260G possibly damaging Het
Ddx3y T C Y: 1,282,919 (GRCm39) N46D probably damaging Het
Dgkz G T 2: 91,769,090 (GRCm39) H653Q probably benign Het
Dnajc16 A T 4: 141,491,945 (GRCm39) I626N possibly damaging Het
Dsc2 T C 18: 20,171,151 (GRCm39) D616G probably benign Het
Dscam A T 16: 96,602,580 (GRCm39) S621T probably damaging Het
Dst T A 1: 34,267,774 (GRCm39) V3058E probably damaging Het
Ep400 A T 5: 110,858,959 (GRCm39) C1125S unknown Het
Glyatl3 G A 17: 41,223,619 (GRCm39) Q41* probably null Het
Gm7694 T G 1: 170,128,927 (GRCm39) I201L probably damaging Het
Gnal C T 18: 67,221,830 (GRCm39) R78* probably null Het
Gtf3c1 T C 7: 125,303,069 (GRCm39) D122G probably benign Het
Htt G T 5: 34,975,095 (GRCm39) D622Y possibly damaging Het
Igkv4-92 A G 6: 68,732,081 (GRCm39) C98R probably benign Het
Incenp G A 19: 9,855,088 (GRCm39) R608* probably null Het
Kics2 A G 10: 121,586,501 (GRCm39) Y272C probably damaging Het
Kif3c G A 12: 3,451,706 (GRCm39) R679H probably damaging Het
Kng1 T A 16: 22,898,146 (GRCm39) H515Q probably damaging Het
Lamb2 T C 9: 108,361,370 (GRCm39) probably null Het
Malrd1 A T 2: 15,850,140 (GRCm39) N1253I unknown Het
Map3k21 A T 8: 126,637,471 (GRCm39) D19V Het
Marchf2 G T 17: 33,915,207 (GRCm39) P129Q probably damaging Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Ms4a4d T A 19: 11,533,564 (GRCm39) D148E possibly damaging Het
Myl4 A G 11: 104,468,384 (GRCm39) D36G probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or2a25 T C 6: 42,889,170 (GRCm39) S238P probably damaging Het
Or5ac24 A T 16: 59,165,929 (GRCm39) I45N probably damaging Het
Or5an11 A G 19: 12,245,704 (GRCm39) T37A probably benign Het
Pard3 G A 8: 128,003,647 (GRCm39) S123N probably damaging Het
Parp8 T C 13: 117,013,126 (GRCm39) N638D probably benign Het
Pgpep1l A T 7: 67,887,406 (GRCm39) S65T probably damaging Het
Ppp1r13b A G 12: 111,796,708 (GRCm39) V1068A probably benign Het
Pramel20 G A 4: 143,298,425 (GRCm39) D123N probably benign Het
Prkd1 G A 12: 50,430,185 (GRCm39) Q641* probably null Het
Ptgr2 T C 12: 84,344,873 (GRCm39) V82A possibly damaging Het
Rbm34 G A 8: 127,686,332 (GRCm39) P225S possibly damaging Het
Rnps1 A T 17: 24,637,496 (GRCm39) K46I unknown Het
Shank1 T C 7: 44,002,409 (GRCm39) V1376A probably benign Het
Ski A T 4: 155,306,317 (GRCm39) Y221N probably damaging Het
Skint6 C A 4: 113,095,347 (GRCm39) G104V probably damaging Het
Slit2 G A 5: 48,459,860 (GRCm39) C1380Y possibly damaging Het
Smpd3 C T 8: 106,984,058 (GRCm39) G554S probably benign Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Spdl1 C A 11: 34,700,535 (GRCm39) C605F possibly damaging Het
Syne1 C A 10: 5,155,406 (GRCm39) D5568Y probably benign Het
Tac1 C A 6: 7,559,141 (GRCm39) A111D possibly damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnfrsf1a T C 6: 125,333,878 (GRCm39) C44R probably damaging Het
Traf3ip3 T C 1: 192,864,285 (GRCm39) Q366R probably benign Het
Trip10 A G 17: 57,569,416 (GRCm39) D479G probably damaging Het
Trip11 T C 12: 101,845,131 (GRCm39) T1536A probably benign Het
Tstd3 G T 4: 21,767,082 (GRCm39) A13E possibly damaging Het
Urb1 T C 16: 90,550,678 (GRCm39) K2058R probably benign Het
Usp15 A T 10: 122,982,703 (GRCm39) I304N possibly damaging Het
Usp18 T G 6: 121,229,529 (GRCm39) H49Q probably benign Het
Vmn1r56 T A 7: 5,199,389 (GRCm39) D76V probably damaging Het
Wnk1 A G 6: 119,939,393 (GRCm39) S167P probably damaging Het
Zfp229 G A 17: 21,965,731 (GRCm39) A654T possibly damaging Het
Zfp977 C T 7: 42,230,082 (GRCm39) V148I probably benign Het
Znfx1 A T 2: 166,880,656 (GRCm39) I1240N Het
Other mutations in Cyp24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp24a1 APN 2 170,338,486 (GRCm39) missense probably damaging 1.00
IGL02187:Cyp24a1 APN 2 170,336,013 (GRCm39) missense probably damaging 1.00
IGL02269:Cyp24a1 APN 2 170,338,492 (GRCm39) missense probably damaging 1.00
IGL02273:Cyp24a1 APN 2 170,338,278 (GRCm39) missense probably damaging 1.00
IGL03089:Cyp24a1 APN 2 170,327,886 (GRCm39) missense probably damaging 1.00
R0359:Cyp24a1 UTSW 2 170,333,619 (GRCm39) missense possibly damaging 0.94
R1037:Cyp24a1 UTSW 2 170,333,537 (GRCm39) missense probably damaging 1.00
R1243:Cyp24a1 UTSW 2 170,337,326 (GRCm39) missense probably benign 0.28
R1601:Cyp24a1 UTSW 2 170,327,611 (GRCm39) missense possibly damaging 0.48
R1696:Cyp24a1 UTSW 2 170,327,963 (GRCm39) missense probably benign 0.10
R1839:Cyp24a1 UTSW 2 170,338,661 (GRCm39) missense probably benign
R1845:Cyp24a1 UTSW 2 170,329,837 (GRCm39) missense probably benign 0.06
R4832:Cyp24a1 UTSW 2 170,338,098 (GRCm39) missense probably benign 0.07
R5649:Cyp24a1 UTSW 2 170,338,229 (GRCm39) missense possibly damaging 0.87
R6320:Cyp24a1 UTSW 2 170,328,704 (GRCm39) missense probably benign 0.13
R6668:Cyp24a1 UTSW 2 170,327,805 (GRCm39) critical splice donor site probably null
R6823:Cyp24a1 UTSW 2 170,329,899 (GRCm39) missense probably benign 0.12
R6953:Cyp24a1 UTSW 2 170,329,866 (GRCm39) missense probably benign
R7136:Cyp24a1 UTSW 2 170,336,063 (GRCm39) missense probably benign 0.15
R7287:Cyp24a1 UTSW 2 170,327,826 (GRCm39) missense probably damaging 1.00
R7831:Cyp24a1 UTSW 2 170,327,860 (GRCm39) missense probably damaging 1.00
R7893:Cyp24a1 UTSW 2 170,338,436 (GRCm39) critical splice donor site probably null
R8193:Cyp24a1 UTSW 2 170,327,622 (GRCm39) missense probably damaging 1.00
R8206:Cyp24a1 UTSW 2 170,333,589 (GRCm39) missense possibly damaging 0.83
R8296:Cyp24a1 UTSW 2 170,332,036 (GRCm39) missense probably damaging 1.00
R8384:Cyp24a1 UTSW 2 170,328,689 (GRCm39) critical splice donor site probably null
R9091:Cyp24a1 UTSW 2 170,327,853 (GRCm39) missense probably damaging 1.00
R9226:Cyp24a1 UTSW 2 170,338,277 (GRCm39) missense probably damaging 1.00
R9270:Cyp24a1 UTSW 2 170,327,853 (GRCm39) missense probably damaging 1.00
R9776:Cyp24a1 UTSW 2 170,338,625 (GRCm39) missense probably benign 0.10
X0061:Cyp24a1 UTSW 2 170,327,910 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACACTCATCTTAGCAGAGAGG -3'
(R):5'- TGGCTGCAGGAAGAGCTTAG -3'

Sequencing Primer
(F):5'- CTGGTACCCAATAGTGTCTAGCAC -3'
(R):5'- GCCTGGGGGAAGACATCAC -3'
Posted On 2021-10-11