Incidental Mutation 'R9005:Dnajc16'
ID 685198
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 068835-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.772) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141491945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 626 (I626N)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038014
AA Change: I626N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: I626N

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,630,075 (GRCm39) probably benign Het
Abcd4 C T 12: 84,655,356 (GRCm39) W369* probably null Het
Abcf3 A G 16: 20,368,056 (GRCm39) E98G probably benign Het
Acaca A T 11: 84,262,410 (GRCm39) D2004V probably damaging Het
Acot5 G C 12: 84,116,630 (GRCm39) M130I Het
Adamts3 C T 5: 89,825,693 (GRCm39) E1049K probably benign Het
Agfg2 A T 5: 137,650,744 (GRCm39) L456Q probably damaging Het
Agtr1b T A 3: 20,370,343 (GRCm39) T88S possibly damaging Het
Amer2 G C 14: 60,617,376 (GRCm39) D524H probably damaging Het
Ankrd61 T A 5: 143,831,676 (GRCm39) T43S probably benign Het
Apcs A G 1: 172,721,776 (GRCm39) L190P probably benign Het
Arsg A G 11: 109,381,346 (GRCm39) K30E probably benign Het
Banp A T 8: 122,705,441 (GRCm39) M104L possibly damaging Het
Caskin1 A G 17: 24,718,111 (GRCm39) Q268R probably benign Het
Ccdc112 A G 18: 46,429,455 (GRCm39) V81A probably damaging Het
Cfap44 T C 16: 44,280,517 (GRCm39) I1432T probably damaging Het
Chd2 A T 7: 73,134,294 (GRCm39) N684K probably damaging Het
Creb1 T C 1: 64,605,478 (GRCm39) probably null Het
Ctsc C T 7: 87,927,502 (GRCm39) T31I probably damaging Het
Cttnbp2 C A 6: 18,434,430 (GRCm39) R476L probably damaging Het
Cwf19l1 T C 19: 44,111,653 (GRCm39) D260G possibly damaging Het
Cyp24a1 A T 2: 170,336,005 (GRCm39) S211T probably damaging Het
Ddx3y T C Y: 1,282,919 (GRCm39) N46D probably damaging Het
Dgkz G T 2: 91,769,090 (GRCm39) H653Q probably benign Het
Dsc2 T C 18: 20,171,151 (GRCm39) D616G probably benign Het
Dscam A T 16: 96,602,580 (GRCm39) S621T probably damaging Het
Dst T A 1: 34,267,774 (GRCm39) V3058E probably damaging Het
Ep400 A T 5: 110,858,959 (GRCm39) C1125S unknown Het
Glyatl3 G A 17: 41,223,619 (GRCm39) Q41* probably null Het
Gm7694 T G 1: 170,128,927 (GRCm39) I201L probably damaging Het
Gnal C T 18: 67,221,830 (GRCm39) R78* probably null Het
Gtf3c1 T C 7: 125,303,069 (GRCm39) D122G probably benign Het
Htt G T 5: 34,975,095 (GRCm39) D622Y possibly damaging Het
Igkv4-92 A G 6: 68,732,081 (GRCm39) C98R probably benign Het
Incenp G A 19: 9,855,088 (GRCm39) R608* probably null Het
Kics2 A G 10: 121,586,501 (GRCm39) Y272C probably damaging Het
Kif3c G A 12: 3,451,706 (GRCm39) R679H probably damaging Het
Kng1 T A 16: 22,898,146 (GRCm39) H515Q probably damaging Het
Lamb2 T C 9: 108,361,370 (GRCm39) probably null Het
Malrd1 A T 2: 15,850,140 (GRCm39) N1253I unknown Het
Map3k21 A T 8: 126,637,471 (GRCm39) D19V Het
Marchf2 G T 17: 33,915,207 (GRCm39) P129Q probably damaging Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Ms4a4d T A 19: 11,533,564 (GRCm39) D148E possibly damaging Het
Myl4 A G 11: 104,468,384 (GRCm39) D36G probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or2a25 T C 6: 42,889,170 (GRCm39) S238P probably damaging Het
Or5ac24 A T 16: 59,165,929 (GRCm39) I45N probably damaging Het
Or5an11 A G 19: 12,245,704 (GRCm39) T37A probably benign Het
Pard3 G A 8: 128,003,647 (GRCm39) S123N probably damaging Het
Parp8 T C 13: 117,013,126 (GRCm39) N638D probably benign Het
Pgpep1l A T 7: 67,887,406 (GRCm39) S65T probably damaging Het
Ppp1r13b A G 12: 111,796,708 (GRCm39) V1068A probably benign Het
Pramel20 G A 4: 143,298,425 (GRCm39) D123N probably benign Het
Prkd1 G A 12: 50,430,185 (GRCm39) Q641* probably null Het
Ptgr2 T C 12: 84,344,873 (GRCm39) V82A possibly damaging Het
Rbm34 G A 8: 127,686,332 (GRCm39) P225S possibly damaging Het
Rnps1 A T 17: 24,637,496 (GRCm39) K46I unknown Het
Shank1 T C 7: 44,002,409 (GRCm39) V1376A probably benign Het
Ski A T 4: 155,306,317 (GRCm39) Y221N probably damaging Het
Skint6 C A 4: 113,095,347 (GRCm39) G104V probably damaging Het
Slit2 G A 5: 48,459,860 (GRCm39) C1380Y possibly damaging Het
Smpd3 C T 8: 106,984,058 (GRCm39) G554S probably benign Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Spdl1 C A 11: 34,700,535 (GRCm39) C605F possibly damaging Het
Syne1 C A 10: 5,155,406 (GRCm39) D5568Y probably benign Het
Tac1 C A 6: 7,559,141 (GRCm39) A111D possibly damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnfrsf1a T C 6: 125,333,878 (GRCm39) C44R probably damaging Het
Traf3ip3 T C 1: 192,864,285 (GRCm39) Q366R probably benign Het
Trip10 A G 17: 57,569,416 (GRCm39) D479G probably damaging Het
Trip11 T C 12: 101,845,131 (GRCm39) T1536A probably benign Het
Tstd3 G T 4: 21,767,082 (GRCm39) A13E possibly damaging Het
Urb1 T C 16: 90,550,678 (GRCm39) K2058R probably benign Het
Usp15 A T 10: 122,982,703 (GRCm39) I304N possibly damaging Het
Usp18 T G 6: 121,229,529 (GRCm39) H49Q probably benign Het
Vmn1r56 T A 7: 5,199,389 (GRCm39) D76V probably damaging Het
Wnk1 A G 6: 119,939,393 (GRCm39) S167P probably damaging Het
Zfp229 G A 17: 21,965,731 (GRCm39) A654T possibly damaging Het
Zfp977 C T 7: 42,230,082 (GRCm39) V148I probably benign Het
Znfx1 A T 2: 166,880,656 (GRCm39) I1240N Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGCTTATTCCAAGTGGAGAGTCC -3'
(R):5'- AGGCGCTCTCAGATTCACTG -3'

Sequencing Primer
(F):5'- ATTCCAAGTGGAGAGTCCTCTTC -3'
(R):5'- CCCACATAATTGAGGCTTGCCTTAAG -3'
Posted On 2021-10-11