Incidental Mutation 'R9005:Dnajc16'
ID 685198
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 4732437J24Rik, 2900037O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141760189-141790931 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141764634 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 626 (I626N)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038014
AA Change: I626N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: I626N

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,652,711 probably benign Het
Abcd4 C T 12: 84,608,582 W369* probably null Het
Abcf3 A G 16: 20,549,306 E98G probably benign Het
Acaca A T 11: 84,371,584 D2004V probably damaging Het
Acot5 G C 12: 84,069,856 M130I Het
Adamts3 C T 5: 89,677,834 E1049K probably benign Het
Agfg2 A T 5: 137,652,482 L456Q probably damaging Het
Agtr1b T A 3: 20,316,179 T88S possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd61 T A 5: 143,894,858 T43S probably benign Het
Apcs A G 1: 172,894,209 L190P probably benign Het
Arsg A G 11: 109,490,520 K30E probably benign Het
Banp A T 8: 121,978,702 M104L possibly damaging Het
BC048403 A G 10: 121,750,596 Y272C probably damaging Het
BC080695 G A 4: 143,571,855 D123N probably benign Het
Caskin1 A G 17: 24,499,137 Q268R probably benign Het
Ccdc112 A G 18: 46,296,388 V81A probably damaging Het
Cfap44 T C 16: 44,460,154 I1432T probably damaging Het
Chd2 A T 7: 73,484,546 N684K probably damaging Het
Creb1 T C 1: 64,566,319 probably null Het
Ctsc C T 7: 88,278,294 T31I probably damaging Het
Cttnbp2 C A 6: 18,434,431 R476L probably damaging Het
Cwf19l1 T C 19: 44,123,214 D260G possibly damaging Het
Cyp24a1 A T 2: 170,494,085 S211T probably damaging Het
Ddx3y T C Y: 1,282,919 N46D probably damaging Het
Dgkz G T 2: 91,938,745 H653Q probably benign Het
Dsc2 T C 18: 20,038,094 D616G probably benign Het
Dscam A T 16: 96,801,380 S621T probably damaging Het
Dst T A 1: 34,228,693 V3058E probably damaging Het
Ep400 A T 5: 110,711,093 C1125S unknown Het
Glyatl3 G A 17: 40,912,728 Q41* probably null Het
Gm7694 T G 1: 170,301,358 I201L probably damaging Het
Gnal C T 18: 67,088,759 R78* probably null Het
Gtf3c1 T C 7: 125,703,897 D122G probably benign Het
Htt G T 5: 34,817,751 D622Y possibly damaging Het
Igkv4-92 A G 6: 68,755,097 C98R probably benign Het
Incenp G A 19: 9,877,724 R608* probably null Het
Kif3c G A 12: 3,401,706 R679H probably damaging Het
Kng1 T A 16: 23,079,396 H515Q probably damaging Het
Lamb2 T C 9: 108,484,171 probably null Het
Malrd1 A T 2: 15,845,329 N1253I unknown Het
Map3k21 A T 8: 125,910,732 D19V Het
March2 G T 17: 33,696,233 P129Q probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a4d T A 19: 11,556,200 D148E possibly damaging Het
Myl4 A G 11: 104,577,558 D36G probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr206 A T 16: 59,345,566 I45N probably damaging Het
Olfr235 A G 19: 12,268,340 T37A probably benign Het
Olfr447 T C 6: 42,912,236 S238P probably damaging Het
Pard3 G A 8: 127,277,166 S123N probably damaging Het
Parp8 T C 13: 116,876,590 N638D probably benign Het
Pgpep1l A T 7: 68,237,658 S65T probably damaging Het
Ppp1r13b A G 12: 111,830,274 V1068A probably benign Het
Prkd1 G A 12: 50,383,402 Q641* probably null Het
Ptgr2 T C 12: 84,298,099 V82A possibly damaging Het
Rbm34 G A 8: 126,959,582 P225S possibly damaging Het
Rnps1 A T 17: 24,418,522 K46I unknown Het
Shank1 T C 7: 44,352,985 V1376A probably benign Het
Ski A T 4: 155,221,860 Y221N probably damaging Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slit2 G A 5: 48,302,518 C1380Y possibly damaging Het
Smpd3 C T 8: 106,257,426 G554S probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Spdl1 C A 11: 34,809,708 C605F possibly damaging Het
Syne1 C A 10: 5,205,406 D5568Y probably benign Het
Tac1 C A 6: 7,559,141 A111D possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnfrsf1a T C 6: 125,356,915 C44R probably damaging Het
Traf3ip3 T C 1: 193,181,977 Q366R probably benign Het
Trip10 A G 17: 57,262,416 D479G probably damaging Het
Trip11 T C 12: 101,878,872 T1536A probably benign Het
Tstd3 G T 4: 21,767,082 A13E possibly damaging Het
Urb1 T C 16: 90,753,790 K2058R probably benign Het
Usp15 A T 10: 123,146,798 I304N possibly damaging Het
Usp18 T G 6: 121,252,570 H49Q probably benign Het
Vmn1r56 T A 7: 5,196,390 D76V probably damaging Het
Wnk1 A G 6: 119,962,432 S167P probably damaging Het
Zfp229 G A 17: 21,746,750 A654T possibly damaging Het
Zfp977 C T 7: 42,580,658 V148I probably benign Het
Znfx1 A T 2: 167,038,736 I1240N Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141763563 splice site probably null
IGL00840:Dnajc16 APN 4 141768003 missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141763697 missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141774629 missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141776933 missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141764647 missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141767732 nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141770949 missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141764685 missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141768007 missense probably benign
R0415:Dnajc16 UTSW 4 141789048 nonsense probably null
R0532:Dnajc16 UTSW 4 141789009 missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141767741 nonsense probably null
R2959:Dnajc16 UTSW 4 141766545 nonsense probably null
R3025:Dnajc16 UTSW 4 141774611 missense probably benign
R3796:Dnajc16 UTSW 4 141767737 missense probably benign
R3854:Dnajc16 UTSW 4 141763653 nonsense probably null
R3856:Dnajc16 UTSW 4 141763653 nonsense probably null
R4661:Dnajc16 UTSW 4 141763548 missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141767969 nonsense probably null
R5126:Dnajc16 UTSW 4 141774509 missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141764683 missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141775392 missense probably benign
R6888:Dnajc16 UTSW 4 141776992 missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141766690 missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141763813 missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141774568 missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141764691 missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141766707 nonsense probably null
R9053:Dnajc16 UTSW 4 141783060 missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141767747 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGCTTATTCCAAGTGGAGAGTCC -3'
(R):5'- AGGCGCTCTCAGATTCACTG -3'

Sequencing Primer
(F):5'- ATTCCAAGTGGAGAGTCCTCTTC -3'
(R):5'- CCCACATAATTGAGGCTTGCCTTAAG -3'
Posted On 2021-10-11