Incidental Mutation 'R9005:Adamts3'
ID 685203
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms 6330442E02Rik, 1100001H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89677087-89883334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89677834 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1049 (E1049K)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: E1048K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: E1048K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: E1049K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: E1049K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,652,711 probably benign Het
Abcd4 C T 12: 84,608,582 W369* probably null Het
Abcf3 A G 16: 20,549,306 E98G probably benign Het
Acaca A T 11: 84,371,584 D2004V probably damaging Het
Acot5 G C 12: 84,069,856 M130I Het
Agfg2 A T 5: 137,652,482 L456Q probably damaging Het
Agtr1b T A 3: 20,316,179 T88S possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd61 T A 5: 143,894,858 T43S probably benign Het
Apcs A G 1: 172,894,209 L190P probably benign Het
Arsg A G 11: 109,490,520 K30E probably benign Het
Banp A T 8: 121,978,702 M104L possibly damaging Het
BC048403 A G 10: 121,750,596 Y272C probably damaging Het
BC080695 G A 4: 143,571,855 D123N probably benign Het
Caskin1 A G 17: 24,499,137 Q268R probably benign Het
Ccdc112 A G 18: 46,296,388 V81A probably damaging Het
Cfap44 T C 16: 44,460,154 I1432T probably damaging Het
Chd2 A T 7: 73,484,546 N684K probably damaging Het
Creb1 T C 1: 64,566,319 probably null Het
Ctsc C T 7: 88,278,294 T31I probably damaging Het
Cttnbp2 C A 6: 18,434,431 R476L probably damaging Het
Cwf19l1 T C 19: 44,123,214 D260G possibly damaging Het
Cyp24a1 A T 2: 170,494,085 S211T probably damaging Het
Ddx3y T C Y: 1,282,919 N46D probably damaging Het
Dgkz G T 2: 91,938,745 H653Q probably benign Het
Dnajc16 A T 4: 141,764,634 I626N possibly damaging Het
Dsc2 T C 18: 20,038,094 D616G probably benign Het
Dscam A T 16: 96,801,380 S621T probably damaging Het
Dst T A 1: 34,228,693 V3058E probably damaging Het
Ep400 A T 5: 110,711,093 C1125S unknown Het
Glyatl3 G A 17: 40,912,728 Q41* probably null Het
Gm7694 T G 1: 170,301,358 I201L probably damaging Het
Gnal C T 18: 67,088,759 R78* probably null Het
Gtf3c1 T C 7: 125,703,897 D122G probably benign Het
Htt G T 5: 34,817,751 D622Y possibly damaging Het
Igkv4-92 A G 6: 68,755,097 C98R probably benign Het
Incenp G A 19: 9,877,724 R608* probably null Het
Kif3c G A 12: 3,401,706 R679H probably damaging Het
Kng1 T A 16: 23,079,396 H515Q probably damaging Het
Lamb2 T C 9: 108,484,171 probably null Het
Malrd1 A T 2: 15,845,329 N1253I unknown Het
Map3k21 A T 8: 125,910,732 D19V Het
March2 G T 17: 33,696,233 P129Q probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a4d T A 19: 11,556,200 D148E possibly damaging Het
Myl4 A G 11: 104,577,558 D36G probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr206 A T 16: 59,345,566 I45N probably damaging Het
Olfr235 A G 19: 12,268,340 T37A probably benign Het
Olfr447 T C 6: 42,912,236 S238P probably damaging Het
Pard3 G A 8: 127,277,166 S123N probably damaging Het
Parp8 T C 13: 116,876,590 N638D probably benign Het
Pgpep1l A T 7: 68,237,658 S65T probably damaging Het
Ppp1r13b A G 12: 111,830,274 V1068A probably benign Het
Prkd1 G A 12: 50,383,402 Q641* probably null Het
Ptgr2 T C 12: 84,298,099 V82A possibly damaging Het
Rbm34 G A 8: 126,959,582 P225S possibly damaging Het
Rnps1 A T 17: 24,418,522 K46I unknown Het
Shank1 T C 7: 44,352,985 V1376A probably benign Het
Ski A T 4: 155,221,860 Y221N probably damaging Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slit2 G A 5: 48,302,518 C1380Y possibly damaging Het
Smpd3 C T 8: 106,257,426 G554S probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Spdl1 C A 11: 34,809,708 C605F possibly damaging Het
Syne1 C A 10: 5,205,406 D5568Y probably benign Het
Tac1 C A 6: 7,559,141 A111D possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnfrsf1a T C 6: 125,356,915 C44R probably damaging Het
Traf3ip3 T C 1: 193,181,977 Q366R probably benign Het
Trip10 A G 17: 57,262,416 D479G probably damaging Het
Trip11 T C 12: 101,878,872 T1536A probably benign Het
Tstd3 G T 4: 21,767,082 A13E possibly damaging Het
Urb1 T C 16: 90,753,790 K2058R probably benign Het
Usp15 A T 10: 123,146,798 I304N possibly damaging Het
Usp18 T G 6: 121,252,570 H49Q probably benign Het
Vmn1r56 T A 7: 5,196,390 D76V probably damaging Het
Wnk1 A G 6: 119,962,432 S167P probably damaging Het
Zfp229 G A 17: 21,746,750 A654T possibly damaging Het
Zfp977 C T 7: 42,580,658 V148I probably benign Het
Znfx1 A T 2: 167,038,736 I1240N Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89702956 missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89694768 missense probably benign 0.19
R8827:Adamts3 UTSW 5 89691465 missense probably benign 0.03
R8864:Adamts3 UTSW 5 89707122 intron probably benign
R8906:Adamts3 UTSW 5 89677716 missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89706711 missense probably benign 0.17
R9378:Adamts3 UTSW 5 89700410 nonsense probably null
R9505:Adamts3 UTSW 5 89707892 missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89686891 missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- TGAAGGCAGCATCCGCATTG -3'
(R):5'- GCTATCTCTGACAGTACATCCTG -3'

Sequencing Primer
(F):5'- TTTGCCATGGAAGAGAAGCTACTC -3'
(R):5'- AGATGAGCCATGTTTGGG -3'
Posted On 2021-10-11