Incidental Mutation 'R9005:Adamts3'
ID 685203
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 068835-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89825693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1049 (E1049K)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: E1048K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: E1048K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: E1049K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: E1049K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,630,075 (GRCm39) probably benign Het
Abcd4 C T 12: 84,655,356 (GRCm39) W369* probably null Het
Abcf3 A G 16: 20,368,056 (GRCm39) E98G probably benign Het
Acaca A T 11: 84,262,410 (GRCm39) D2004V probably damaging Het
Acot5 G C 12: 84,116,630 (GRCm39) M130I Het
Agfg2 A T 5: 137,650,744 (GRCm39) L456Q probably damaging Het
Agtr1b T A 3: 20,370,343 (GRCm39) T88S possibly damaging Het
Amer2 G C 14: 60,617,376 (GRCm39) D524H probably damaging Het
Ankrd61 T A 5: 143,831,676 (GRCm39) T43S probably benign Het
Apcs A G 1: 172,721,776 (GRCm39) L190P probably benign Het
Arsg A G 11: 109,381,346 (GRCm39) K30E probably benign Het
Banp A T 8: 122,705,441 (GRCm39) M104L possibly damaging Het
Caskin1 A G 17: 24,718,111 (GRCm39) Q268R probably benign Het
Ccdc112 A G 18: 46,429,455 (GRCm39) V81A probably damaging Het
Cfap44 T C 16: 44,280,517 (GRCm39) I1432T probably damaging Het
Chd2 A T 7: 73,134,294 (GRCm39) N684K probably damaging Het
Creb1 T C 1: 64,605,478 (GRCm39) probably null Het
Ctsc C T 7: 87,927,502 (GRCm39) T31I probably damaging Het
Cttnbp2 C A 6: 18,434,430 (GRCm39) R476L probably damaging Het
Cwf19l1 T C 19: 44,111,653 (GRCm39) D260G possibly damaging Het
Cyp24a1 A T 2: 170,336,005 (GRCm39) S211T probably damaging Het
Ddx3y T C Y: 1,282,919 (GRCm39) N46D probably damaging Het
Dgkz G T 2: 91,769,090 (GRCm39) H653Q probably benign Het
Dnajc16 A T 4: 141,491,945 (GRCm39) I626N possibly damaging Het
Dsc2 T C 18: 20,171,151 (GRCm39) D616G probably benign Het
Dscam A T 16: 96,602,580 (GRCm39) S621T probably damaging Het
Dst T A 1: 34,267,774 (GRCm39) V3058E probably damaging Het
Ep400 A T 5: 110,858,959 (GRCm39) C1125S unknown Het
Glyatl3 G A 17: 41,223,619 (GRCm39) Q41* probably null Het
Gm7694 T G 1: 170,128,927 (GRCm39) I201L probably damaging Het
Gnal C T 18: 67,221,830 (GRCm39) R78* probably null Het
Gtf3c1 T C 7: 125,303,069 (GRCm39) D122G probably benign Het
Htt G T 5: 34,975,095 (GRCm39) D622Y possibly damaging Het
Igkv4-92 A G 6: 68,732,081 (GRCm39) C98R probably benign Het
Incenp G A 19: 9,855,088 (GRCm39) R608* probably null Het
Kics2 A G 10: 121,586,501 (GRCm39) Y272C probably damaging Het
Kif3c G A 12: 3,451,706 (GRCm39) R679H probably damaging Het
Kng1 T A 16: 22,898,146 (GRCm39) H515Q probably damaging Het
Lamb2 T C 9: 108,361,370 (GRCm39) probably null Het
Malrd1 A T 2: 15,850,140 (GRCm39) N1253I unknown Het
Map3k21 A T 8: 126,637,471 (GRCm39) D19V Het
Marchf2 G T 17: 33,915,207 (GRCm39) P129Q probably damaging Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Ms4a4d T A 19: 11,533,564 (GRCm39) D148E possibly damaging Het
Myl4 A G 11: 104,468,384 (GRCm39) D36G probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or2a25 T C 6: 42,889,170 (GRCm39) S238P probably damaging Het
Or5ac24 A T 16: 59,165,929 (GRCm39) I45N probably damaging Het
Or5an11 A G 19: 12,245,704 (GRCm39) T37A probably benign Het
Pard3 G A 8: 128,003,647 (GRCm39) S123N probably damaging Het
Parp8 T C 13: 117,013,126 (GRCm39) N638D probably benign Het
Pgpep1l A T 7: 67,887,406 (GRCm39) S65T probably damaging Het
Ppp1r13b A G 12: 111,796,708 (GRCm39) V1068A probably benign Het
Pramel20 G A 4: 143,298,425 (GRCm39) D123N probably benign Het
Prkd1 G A 12: 50,430,185 (GRCm39) Q641* probably null Het
Ptgr2 T C 12: 84,344,873 (GRCm39) V82A possibly damaging Het
Rbm34 G A 8: 127,686,332 (GRCm39) P225S possibly damaging Het
Rnps1 A T 17: 24,637,496 (GRCm39) K46I unknown Het
Shank1 T C 7: 44,002,409 (GRCm39) V1376A probably benign Het
Ski A T 4: 155,306,317 (GRCm39) Y221N probably damaging Het
Skint6 C A 4: 113,095,347 (GRCm39) G104V probably damaging Het
Slit2 G A 5: 48,459,860 (GRCm39) C1380Y possibly damaging Het
Smpd3 C T 8: 106,984,058 (GRCm39) G554S probably benign Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Spdl1 C A 11: 34,700,535 (GRCm39) C605F possibly damaging Het
Syne1 C A 10: 5,155,406 (GRCm39) D5568Y probably benign Het
Tac1 C A 6: 7,559,141 (GRCm39) A111D possibly damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnfrsf1a T C 6: 125,333,878 (GRCm39) C44R probably damaging Het
Traf3ip3 T C 1: 192,864,285 (GRCm39) Q366R probably benign Het
Trip10 A G 17: 57,569,416 (GRCm39) D479G probably damaging Het
Trip11 T C 12: 101,845,131 (GRCm39) T1536A probably benign Het
Tstd3 G T 4: 21,767,082 (GRCm39) A13E possibly damaging Het
Urb1 T C 16: 90,550,678 (GRCm39) K2058R probably benign Het
Usp15 A T 10: 122,982,703 (GRCm39) I304N possibly damaging Het
Usp18 T G 6: 121,229,529 (GRCm39) H49Q probably benign Het
Vmn1r56 T A 7: 5,199,389 (GRCm39) D76V probably damaging Het
Wnk1 A G 6: 119,939,393 (GRCm39) S167P probably damaging Het
Zfp229 G A 17: 21,965,731 (GRCm39) A654T possibly damaging Het
Zfp977 C T 7: 42,230,082 (GRCm39) V148I probably benign Het
Znfx1 A T 2: 166,880,656 (GRCm39) I1240N Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGGCAGCATCCGCATTG -3'
(R):5'- GCTATCTCTGACAGTACATCCTG -3'

Sequencing Primer
(F):5'- TTTGCCATGGAAGAGAAGCTACTC -3'
(R):5'- AGATGAGCCATGTTTGGG -3'
Posted On 2021-10-11