Incidental Mutation 'R9005:Spdl1'
ID 685232
Institutional Source Beutler Lab
Gene Symbol Spdl1
Ensembl Gene ENSMUSG00000069910
Gene Name spindle apparatus coiled-coil protein 1
Synonyms 2600001J17Rik, Ccdc99, 1700018I02Rik, 2810049B11Rik
MMRRC Submission 068835-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.859) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 34700017-34724468 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34700535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 605 (C605F)
Ref Sequence ENSEMBL: ENSMUSP00000090882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093191]
AlphaFold Q923A2
Predicted Effect possibly damaging
Transcript: ENSMUST00000093191
AA Change: C605F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: C605F

DomainStartEndE-ValueType
coiled coil region 35 342 N/A INTRINSIC
coiled coil region 370 441 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,630,075 (GRCm39) probably benign Het
Abcd4 C T 12: 84,655,356 (GRCm39) W369* probably null Het
Abcf3 A G 16: 20,368,056 (GRCm39) E98G probably benign Het
Acaca A T 11: 84,262,410 (GRCm39) D2004V probably damaging Het
Acot5 G C 12: 84,116,630 (GRCm39) M130I Het
Adamts3 C T 5: 89,825,693 (GRCm39) E1049K probably benign Het
Agfg2 A T 5: 137,650,744 (GRCm39) L456Q probably damaging Het
Agtr1b T A 3: 20,370,343 (GRCm39) T88S possibly damaging Het
Amer2 G C 14: 60,617,376 (GRCm39) D524H probably damaging Het
Ankrd61 T A 5: 143,831,676 (GRCm39) T43S probably benign Het
Apcs A G 1: 172,721,776 (GRCm39) L190P probably benign Het
Arsg A G 11: 109,381,346 (GRCm39) K30E probably benign Het
Banp A T 8: 122,705,441 (GRCm39) M104L possibly damaging Het
Caskin1 A G 17: 24,718,111 (GRCm39) Q268R probably benign Het
Ccdc112 A G 18: 46,429,455 (GRCm39) V81A probably damaging Het
Cfap44 T C 16: 44,280,517 (GRCm39) I1432T probably damaging Het
Chd2 A T 7: 73,134,294 (GRCm39) N684K probably damaging Het
Creb1 T C 1: 64,605,478 (GRCm39) probably null Het
Ctsc C T 7: 87,927,502 (GRCm39) T31I probably damaging Het
Cttnbp2 C A 6: 18,434,430 (GRCm39) R476L probably damaging Het
Cwf19l1 T C 19: 44,111,653 (GRCm39) D260G possibly damaging Het
Cyp24a1 A T 2: 170,336,005 (GRCm39) S211T probably damaging Het
Ddx3y T C Y: 1,282,919 (GRCm39) N46D probably damaging Het
Dgkz G T 2: 91,769,090 (GRCm39) H653Q probably benign Het
Dnajc16 A T 4: 141,491,945 (GRCm39) I626N possibly damaging Het
Dsc2 T C 18: 20,171,151 (GRCm39) D616G probably benign Het
Dscam A T 16: 96,602,580 (GRCm39) S621T probably damaging Het
Dst T A 1: 34,267,774 (GRCm39) V3058E probably damaging Het
Ep400 A T 5: 110,858,959 (GRCm39) C1125S unknown Het
Glyatl3 G A 17: 41,223,619 (GRCm39) Q41* probably null Het
Gm7694 T G 1: 170,128,927 (GRCm39) I201L probably damaging Het
Gnal C T 18: 67,221,830 (GRCm39) R78* probably null Het
Gtf3c1 T C 7: 125,303,069 (GRCm39) D122G probably benign Het
Htt G T 5: 34,975,095 (GRCm39) D622Y possibly damaging Het
Igkv4-92 A G 6: 68,732,081 (GRCm39) C98R probably benign Het
Incenp G A 19: 9,855,088 (GRCm39) R608* probably null Het
Kics2 A G 10: 121,586,501 (GRCm39) Y272C probably damaging Het
Kif3c G A 12: 3,451,706 (GRCm39) R679H probably damaging Het
Kng1 T A 16: 22,898,146 (GRCm39) H515Q probably damaging Het
Lamb2 T C 9: 108,361,370 (GRCm39) probably null Het
Malrd1 A T 2: 15,850,140 (GRCm39) N1253I unknown Het
Map3k21 A T 8: 126,637,471 (GRCm39) D19V Het
Marchf2 G T 17: 33,915,207 (GRCm39) P129Q probably damaging Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Ms4a4d T A 19: 11,533,564 (GRCm39) D148E possibly damaging Het
Myl4 A G 11: 104,468,384 (GRCm39) D36G probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or2a25 T C 6: 42,889,170 (GRCm39) S238P probably damaging Het
Or5ac24 A T 16: 59,165,929 (GRCm39) I45N probably damaging Het
Or5an11 A G 19: 12,245,704 (GRCm39) T37A probably benign Het
Pard3 G A 8: 128,003,647 (GRCm39) S123N probably damaging Het
Parp8 T C 13: 117,013,126 (GRCm39) N638D probably benign Het
Pgpep1l A T 7: 67,887,406 (GRCm39) S65T probably damaging Het
Ppp1r13b A G 12: 111,796,708 (GRCm39) V1068A probably benign Het
Pramel20 G A 4: 143,298,425 (GRCm39) D123N probably benign Het
Prkd1 G A 12: 50,430,185 (GRCm39) Q641* probably null Het
Ptgr2 T C 12: 84,344,873 (GRCm39) V82A possibly damaging Het
Rbm34 G A 8: 127,686,332 (GRCm39) P225S possibly damaging Het
Rnps1 A T 17: 24,637,496 (GRCm39) K46I unknown Het
Shank1 T C 7: 44,002,409 (GRCm39) V1376A probably benign Het
Ski A T 4: 155,306,317 (GRCm39) Y221N probably damaging Het
Skint6 C A 4: 113,095,347 (GRCm39) G104V probably damaging Het
Slit2 G A 5: 48,459,860 (GRCm39) C1380Y possibly damaging Het
Smpd3 C T 8: 106,984,058 (GRCm39) G554S probably benign Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Syne1 C A 10: 5,155,406 (GRCm39) D5568Y probably benign Het
Tac1 C A 6: 7,559,141 (GRCm39) A111D possibly damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnfrsf1a T C 6: 125,333,878 (GRCm39) C44R probably damaging Het
Traf3ip3 T C 1: 192,864,285 (GRCm39) Q366R probably benign Het
Trip10 A G 17: 57,569,416 (GRCm39) D479G probably damaging Het
Trip11 T C 12: 101,845,131 (GRCm39) T1536A probably benign Het
Tstd3 G T 4: 21,767,082 (GRCm39) A13E possibly damaging Het
Urb1 T C 16: 90,550,678 (GRCm39) K2058R probably benign Het
Usp15 A T 10: 122,982,703 (GRCm39) I304N possibly damaging Het
Usp18 T G 6: 121,229,529 (GRCm39) H49Q probably benign Het
Vmn1r56 T A 7: 5,199,389 (GRCm39) D76V probably damaging Het
Wnk1 A G 6: 119,939,393 (GRCm39) S167P probably damaging Het
Zfp229 G A 17: 21,965,731 (GRCm39) A654T possibly damaging Het
Zfp977 C T 7: 42,230,082 (GRCm39) V148I probably benign Het
Znfx1 A T 2: 166,880,656 (GRCm39) I1240N Het
Other mutations in Spdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Spdl1 APN 11 34,704,181 (GRCm39) missense probably benign 0.27
IGL02694:Spdl1 APN 11 34,704,448 (GRCm39) missense probably benign 0.05
IGL03131:Spdl1 APN 11 34,721,592 (GRCm39) missense possibly damaging 0.46
R0295:Spdl1 UTSW 11 34,704,170 (GRCm39) missense possibly damaging 0.82
R0319:Spdl1 UTSW 11 34,714,347 (GRCm39) missense possibly damaging 0.66
R1017:Spdl1 UTSW 11 34,710,117 (GRCm39) missense possibly damaging 0.66
R1195:Spdl1 UTSW 11 34,710,644 (GRCm39) missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34,710,644 (GRCm39) missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34,710,644 (GRCm39) missense probably damaging 0.97
R1296:Spdl1 UTSW 11 34,704,434 (GRCm39) missense unknown
R1315:Spdl1 UTSW 11 34,704,234 (GRCm39) missense unknown
R1799:Spdl1 UTSW 11 34,711,856 (GRCm39) nonsense probably null
R2002:Spdl1 UTSW 11 34,713,473 (GRCm39) missense probably benign
R2291:Spdl1 UTSW 11 34,710,136 (GRCm39) nonsense probably null
R4771:Spdl1 UTSW 11 34,704,154 (GRCm39) missense probably damaging 0.98
R5030:Spdl1 UTSW 11 34,714,267 (GRCm39) missense probably benign 0.00
R5167:Spdl1 UTSW 11 34,704,187 (GRCm39) missense possibly damaging 0.79
R5477:Spdl1 UTSW 11 34,713,037 (GRCm39) missense possibly damaging 0.66
R6258:Spdl1 UTSW 11 34,710,713 (GRCm39) missense probably damaging 0.97
R6260:Spdl1 UTSW 11 34,710,713 (GRCm39) missense probably damaging 0.97
R6554:Spdl1 UTSW 11 34,713,397 (GRCm39) missense possibly damaging 0.82
R6695:Spdl1 UTSW 11 34,713,830 (GRCm39) splice site probably null
R6714:Spdl1 UTSW 11 34,713,830 (GRCm39) splice site probably null
R6980:Spdl1 UTSW 11 34,721,706 (GRCm39) start codon destroyed probably null 0.04
R7355:Spdl1 UTSW 11 34,714,191 (GRCm39) missense not run
R7791:Spdl1 UTSW 11 34,704,304 (GRCm39) missense possibly damaging 0.83
R7844:Spdl1 UTSW 11 34,704,170 (GRCm39) missense possibly damaging 0.82
R8029:Spdl1 UTSW 11 34,713,419 (GRCm39) missense probably benign 0.00
R8515:Spdl1 UTSW 11 34,704,252 (GRCm39) missense possibly damaging 0.92
R8923:Spdl1 UTSW 11 34,704,478 (GRCm39) missense possibly damaging 0.66
R9502:Spdl1 UTSW 11 34,713,283 (GRCm39) missense possibly damaging 0.66
Z1176:Spdl1 UTSW 11 34,713,284 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCATCAGTTAAGGACTTATGGGTC -3'
(R):5'- CCCGTTAGTCGCCGTATTTAG -3'

Sequencing Primer
(F):5'- TTATGGGTCAGAATCACAGCC -3'
(R):5'- GTCGCCGTATTTAGACATACTAGGC -3'
Posted On 2021-10-11