Incidental Mutation 'R9005:Acaca'
ID 685234
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms LOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84129672-84401651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84371584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 2004 (D2004V)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: D2004V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: D2004V

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: D2004V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: D2004V

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,652,711 probably benign Het
Abcd4 C T 12: 84,608,582 W369* probably null Het
Abcf3 A G 16: 20,549,306 E98G probably benign Het
Acot5 G C 12: 84,069,856 M130I Het
Adamts3 C T 5: 89,677,834 E1049K probably benign Het
Agfg2 A T 5: 137,652,482 L456Q probably damaging Het
Agtr1b T A 3: 20,316,179 T88S possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd61 T A 5: 143,894,858 T43S probably benign Het
Apcs A G 1: 172,894,209 L190P probably benign Het
Arsg A G 11: 109,490,520 K30E probably benign Het
Banp A T 8: 121,978,702 M104L possibly damaging Het
BC048403 A G 10: 121,750,596 Y272C probably damaging Het
BC080695 G A 4: 143,571,855 D123N probably benign Het
Caskin1 A G 17: 24,499,137 Q268R probably benign Het
Ccdc112 A G 18: 46,296,388 V81A probably damaging Het
Cfap44 T C 16: 44,460,154 I1432T probably damaging Het
Chd2 A T 7: 73,484,546 N684K probably damaging Het
Creb1 T C 1: 64,566,319 probably null Het
Ctsc C T 7: 88,278,294 T31I probably damaging Het
Cttnbp2 C A 6: 18,434,431 R476L probably damaging Het
Cwf19l1 T C 19: 44,123,214 D260G possibly damaging Het
Cyp24a1 A T 2: 170,494,085 S211T probably damaging Het
Ddx3y T C Y: 1,282,919 N46D probably damaging Het
Dgkz G T 2: 91,938,745 H653Q probably benign Het
Dnajc16 A T 4: 141,764,634 I626N possibly damaging Het
Dsc2 T C 18: 20,038,094 D616G probably benign Het
Dscam A T 16: 96,801,380 S621T probably damaging Het
Dst T A 1: 34,228,693 V3058E probably damaging Het
Ep400 A T 5: 110,711,093 C1125S unknown Het
Glyatl3 G A 17: 40,912,728 Q41* probably null Het
Gm7694 T G 1: 170,301,358 I201L probably damaging Het
Gnal C T 18: 67,088,759 R78* probably null Het
Gtf3c1 T C 7: 125,703,897 D122G probably benign Het
Htt G T 5: 34,817,751 D622Y possibly damaging Het
Igkv4-92 A G 6: 68,755,097 C98R probably benign Het
Incenp G A 19: 9,877,724 R608* probably null Het
Kif3c G A 12: 3,401,706 R679H probably damaging Het
Kng1 T A 16: 23,079,396 H515Q probably damaging Het
Lamb2 T C 9: 108,484,171 probably null Het
Malrd1 A T 2: 15,845,329 N1253I unknown Het
Map3k21 A T 8: 125,910,732 D19V Het
March2 G T 17: 33,696,233 P129Q probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a4d T A 19: 11,556,200 D148E possibly damaging Het
Myl4 A G 11: 104,577,558 D36G probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr206 A T 16: 59,345,566 I45N probably damaging Het
Olfr235 A G 19: 12,268,340 T37A probably benign Het
Olfr447 T C 6: 42,912,236 S238P probably damaging Het
Pard3 G A 8: 127,277,166 S123N probably damaging Het
Parp8 T C 13: 116,876,590 N638D probably benign Het
Pgpep1l A T 7: 68,237,658 S65T probably damaging Het
Ppp1r13b A G 12: 111,830,274 V1068A probably benign Het
Prkd1 G A 12: 50,383,402 Q641* probably null Het
Ptgr2 T C 12: 84,298,099 V82A possibly damaging Het
Rbm34 G A 8: 126,959,582 P225S possibly damaging Het
Rnps1 A T 17: 24,418,522 K46I unknown Het
Shank1 T C 7: 44,352,985 V1376A probably benign Het
Ski A T 4: 155,221,860 Y221N probably damaging Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slit2 G A 5: 48,302,518 C1380Y possibly damaging Het
Smpd3 C T 8: 106,257,426 G554S probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Spdl1 C A 11: 34,809,708 C605F possibly damaging Het
Syne1 C A 10: 5,205,406 D5568Y probably benign Het
Tac1 C A 6: 7,559,141 A111D possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnfrsf1a T C 6: 125,356,915 C44R probably damaging Het
Traf3ip3 T C 1: 193,181,977 Q366R probably benign Het
Trip10 A G 17: 57,262,416 D479G probably damaging Het
Trip11 T C 12: 101,878,872 T1536A probably benign Het
Tstd3 G T 4: 21,767,082 A13E possibly damaging Het
Urb1 T C 16: 90,753,790 K2058R probably benign Het
Usp15 A T 10: 123,146,798 I304N possibly damaging Het
Usp18 T G 6: 121,252,570 H49Q probably benign Het
Vmn1r56 T A 7: 5,196,390 D76V probably damaging Het
Wnk1 A G 6: 119,962,432 S167P probably damaging Het
Zfp229 G A 17: 21,746,750 A654T possibly damaging Het
Zfp977 C T 7: 42,580,658 V148I probably benign Het
Znfx1 A T 2: 167,038,736 I1240N Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
effervescence UTSW 11 84262474 missense probably benign 0.41
fizz UTSW 11 84245856 missense probably damaging 0.98
greenhouse UTSW 11 84338356 missense probably damaging 1.00
Serene UTSW 11 84311409 splice site probably null
Tranquil UTSW 11 84280461 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 splice site probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7915:Acaca UTSW 11 84276588 missense probably benign
R7956:Acaca UTSW 11 84320580 missense probably damaging 0.98
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
R8545:Acaca UTSW 11 84345968 missense probably damaging 1.00
R8722:Acaca UTSW 11 84338457 missense possibly damaging 0.85
R9130:Acaca UTSW 11 84311319 missense probably damaging 1.00
R9397:Acaca UTSW 11 84368725 missense probably damaging 1.00
R9489:Acaca UTSW 11 84293016 missense probably benign 0.01
R9540:Acaca UTSW 11 84243411 missense probably damaging 1.00
R9593:Acaca UTSW 11 84380513 nonsense probably null
R9605:Acaca UTSW 11 84293016 missense probably benign 0.01
R9634:Acaca UTSW 11 84293990 missense probably benign 0.00
R9720:Acaca UTSW 11 84263357 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCACATTTAACCCCAGAAG -3'
(R):5'- TTCTGCAATCGTTTCAGGCGG -3'

Sequencing Primer
(F):5'- TTTAACCCCAGAAGCATCAGC -3'
(R):5'- GCGGCTGCCACTCTTTC -3'
Posted On 2021-10-11