Incidental Mutation 'R9005:Acaca'
ID 685234
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms Acc1, LOC327983, Acac, acetyl-CoA carboxylase, A530025K05Rik
MMRRC Submission 068835-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84020498-84292477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84262410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 2004 (D2004V)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: D2004V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: D2004V

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: D2004V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: D2004V

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,630,075 (GRCm39) probably benign Het
Abcd4 C T 12: 84,655,356 (GRCm39) W369* probably null Het
Abcf3 A G 16: 20,368,056 (GRCm39) E98G probably benign Het
Acot5 G C 12: 84,116,630 (GRCm39) M130I Het
Adamts3 C T 5: 89,825,693 (GRCm39) E1049K probably benign Het
Agfg2 A T 5: 137,650,744 (GRCm39) L456Q probably damaging Het
Agtr1b T A 3: 20,370,343 (GRCm39) T88S possibly damaging Het
Amer2 G C 14: 60,617,376 (GRCm39) D524H probably damaging Het
Ankrd61 T A 5: 143,831,676 (GRCm39) T43S probably benign Het
Apcs A G 1: 172,721,776 (GRCm39) L190P probably benign Het
Arsg A G 11: 109,381,346 (GRCm39) K30E probably benign Het
Banp A T 8: 122,705,441 (GRCm39) M104L possibly damaging Het
Caskin1 A G 17: 24,718,111 (GRCm39) Q268R probably benign Het
Ccdc112 A G 18: 46,429,455 (GRCm39) V81A probably damaging Het
Cfap44 T C 16: 44,280,517 (GRCm39) I1432T probably damaging Het
Chd2 A T 7: 73,134,294 (GRCm39) N684K probably damaging Het
Creb1 T C 1: 64,605,478 (GRCm39) probably null Het
Ctsc C T 7: 87,927,502 (GRCm39) T31I probably damaging Het
Cttnbp2 C A 6: 18,434,430 (GRCm39) R476L probably damaging Het
Cwf19l1 T C 19: 44,111,653 (GRCm39) D260G possibly damaging Het
Cyp24a1 A T 2: 170,336,005 (GRCm39) S211T probably damaging Het
Ddx3y T C Y: 1,282,919 (GRCm39) N46D probably damaging Het
Dgkz G T 2: 91,769,090 (GRCm39) H653Q probably benign Het
Dnajc16 A T 4: 141,491,945 (GRCm39) I626N possibly damaging Het
Dsc2 T C 18: 20,171,151 (GRCm39) D616G probably benign Het
Dscam A T 16: 96,602,580 (GRCm39) S621T probably damaging Het
Dst T A 1: 34,267,774 (GRCm39) V3058E probably damaging Het
Ep400 A T 5: 110,858,959 (GRCm39) C1125S unknown Het
Glyatl3 G A 17: 41,223,619 (GRCm39) Q41* probably null Het
Gm7694 T G 1: 170,128,927 (GRCm39) I201L probably damaging Het
Gnal C T 18: 67,221,830 (GRCm39) R78* probably null Het
Gtf3c1 T C 7: 125,303,069 (GRCm39) D122G probably benign Het
Htt G T 5: 34,975,095 (GRCm39) D622Y possibly damaging Het
Igkv4-92 A G 6: 68,732,081 (GRCm39) C98R probably benign Het
Incenp G A 19: 9,855,088 (GRCm39) R608* probably null Het
Kics2 A G 10: 121,586,501 (GRCm39) Y272C probably damaging Het
Kif3c G A 12: 3,451,706 (GRCm39) R679H probably damaging Het
Kng1 T A 16: 22,898,146 (GRCm39) H515Q probably damaging Het
Lamb2 T C 9: 108,361,370 (GRCm39) probably null Het
Malrd1 A T 2: 15,850,140 (GRCm39) N1253I unknown Het
Map3k21 A T 8: 126,637,471 (GRCm39) D19V Het
Marchf2 G T 17: 33,915,207 (GRCm39) P129Q probably damaging Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Ms4a4d T A 19: 11,533,564 (GRCm39) D148E possibly damaging Het
Myl4 A G 11: 104,468,384 (GRCm39) D36G probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or2a25 T C 6: 42,889,170 (GRCm39) S238P probably damaging Het
Or5ac24 A T 16: 59,165,929 (GRCm39) I45N probably damaging Het
Or5an11 A G 19: 12,245,704 (GRCm39) T37A probably benign Het
Pard3 G A 8: 128,003,647 (GRCm39) S123N probably damaging Het
Parp8 T C 13: 117,013,126 (GRCm39) N638D probably benign Het
Pgpep1l A T 7: 67,887,406 (GRCm39) S65T probably damaging Het
Ppp1r13b A G 12: 111,796,708 (GRCm39) V1068A probably benign Het
Pramel20 G A 4: 143,298,425 (GRCm39) D123N probably benign Het
Prkd1 G A 12: 50,430,185 (GRCm39) Q641* probably null Het
Ptgr2 T C 12: 84,344,873 (GRCm39) V82A possibly damaging Het
Rbm34 G A 8: 127,686,332 (GRCm39) P225S possibly damaging Het
Rnps1 A T 17: 24,637,496 (GRCm39) K46I unknown Het
Shank1 T C 7: 44,002,409 (GRCm39) V1376A probably benign Het
Ski A T 4: 155,306,317 (GRCm39) Y221N probably damaging Het
Skint6 C A 4: 113,095,347 (GRCm39) G104V probably damaging Het
Slit2 G A 5: 48,459,860 (GRCm39) C1380Y possibly damaging Het
Smpd3 C T 8: 106,984,058 (GRCm39) G554S probably benign Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Spdl1 C A 11: 34,700,535 (GRCm39) C605F possibly damaging Het
Syne1 C A 10: 5,155,406 (GRCm39) D5568Y probably benign Het
Tac1 C A 6: 7,559,141 (GRCm39) A111D possibly damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnfrsf1a T C 6: 125,333,878 (GRCm39) C44R probably damaging Het
Traf3ip3 T C 1: 192,864,285 (GRCm39) Q366R probably benign Het
Trip10 A G 17: 57,569,416 (GRCm39) D479G probably damaging Het
Trip11 T C 12: 101,845,131 (GRCm39) T1536A probably benign Het
Tstd3 G T 4: 21,767,082 (GRCm39) A13E possibly damaging Het
Urb1 T C 16: 90,550,678 (GRCm39) K2058R probably benign Het
Usp15 A T 10: 122,982,703 (GRCm39) I304N possibly damaging Het
Usp18 T G 6: 121,229,529 (GRCm39) H49Q probably benign Het
Vmn1r56 T A 7: 5,199,389 (GRCm39) D76V probably damaging Het
Wnk1 A G 6: 119,939,393 (GRCm39) S167P probably damaging Het
Zfp229 G A 17: 21,965,731 (GRCm39) A654T possibly damaging Het
Zfp977 C T 7: 42,230,082 (GRCm39) V148I probably benign Het
Znfx1 A T 2: 166,880,656 (GRCm39) I1240N Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84,169,743 (GRCm39) missense probably damaging 1.00
IGL01134:Acaca APN 11 84,142,105 (GRCm39) missense probably benign 0.22
IGL01446:Acaca APN 11 84,151,457 (GRCm39) missense probably damaging 1.00
IGL01591:Acaca APN 11 84,134,146 (GRCm39) missense probably damaging 1.00
IGL01663:Acaca APN 11 84,168,628 (GRCm39) missense possibly damaging 0.85
IGL01767:Acaca APN 11 84,211,368 (GRCm39) missense probably benign 0.01
IGL02206:Acaca APN 11 84,151,573 (GRCm39) nonsense probably null
IGL02335:Acaca APN 11 84,105,084 (GRCm39) missense possibly damaging 0.84
IGL02477:Acaca APN 11 84,197,994 (GRCm39) splice site probably benign
IGL02515:Acaca APN 11 84,153,229 (GRCm39) missense probably benign
IGL02651:Acaca APN 11 84,136,030 (GRCm39) splice site probably benign
IGL02805:Acaca APN 11 84,113,959 (GRCm39) splice site probably benign
IGL03328:Acaca APN 11 84,211,355 (GRCm39) missense probably benign 0.00
effervescence UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
fizz UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
greenhouse UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
Serene UTSW 11 84,202,235 (GRCm39) splice site probably null
Tranquil UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
vitamin UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84,206,678 (GRCm39) missense probably damaging 1.00
R0385:Acaca UTSW 11 84,122,574 (GRCm39) missense probably benign 0.01
R0518:Acaca UTSW 11 84,181,112 (GRCm39) critical splice acceptor site probably null
R0536:Acaca UTSW 11 84,171,342 (GRCm39) splice site probably benign
R0962:Acaca UTSW 11 84,202,129 (GRCm39) missense probably damaging 1.00
R0968:Acaca UTSW 11 84,129,859 (GRCm39) nonsense probably null
R1123:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.09
R1452:Acaca UTSW 11 84,185,885 (GRCm39) splice site probably benign
R1478:Acaca UTSW 11 84,263,453 (GRCm39) missense probably damaging 1.00
R1500:Acaca UTSW 11 84,184,810 (GRCm39) missense probably benign 0.00
R1512:Acaca UTSW 11 84,086,295 (GRCm39) missense probably benign 0.00
R1657:Acaca UTSW 11 84,154,910 (GRCm39) missense probably benign 0.09
R1681:Acaca UTSW 11 84,117,011 (GRCm39) missense probably damaging 1.00
R1682:Acaca UTSW 11 84,283,043 (GRCm39) missense probably benign 0.23
R1688:Acaca UTSW 11 84,129,722 (GRCm39) missense probably damaging 1.00
R1755:Acaca UTSW 11 84,167,390 (GRCm39) frame shift probably null
R1775:Acaca UTSW 11 84,191,248 (GRCm39) missense possibly damaging 0.56
R1793:Acaca UTSW 11 84,229,219 (GRCm39) missense probably damaging 1.00
R1793:Acaca UTSW 11 84,206,795 (GRCm39) missense probably damaging 0.98
R1855:Acaca UTSW 11 84,262,380 (GRCm39) missense probably damaging 0.96
R1881:Acaca UTSW 11 84,191,297 (GRCm39) splice site probably benign
R1881:Acaca UTSW 11 84,161,213 (GRCm39) nonsense probably null
R1989:Acaca UTSW 11 84,153,355 (GRCm39) missense probably damaging 0.98
R2147:Acaca UTSW 11 84,167,362 (GRCm39) missense probably benign 0.03
R2215:Acaca UTSW 11 84,254,619 (GRCm39) missense probably damaging 1.00
R2238:Acaca UTSW 11 84,282,331 (GRCm39) splice site probably benign
R2252:Acaca UTSW 11 84,262,358 (GRCm39) missense probably damaging 0.99
R2316:Acaca UTSW 11 84,185,809 (GRCm39) missense possibly damaging 0.69
R2316:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.16
R2337:Acaca UTSW 11 84,148,023 (GRCm39) missense possibly damaging 0.93
R2697:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3551:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3552:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3748:Acaca UTSW 11 84,202,235 (GRCm39) splice site probably null
R3844:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3873:Acaca UTSW 11 84,203,547 (GRCm39) unclassified probably benign
R4152:Acaca UTSW 11 84,183,752 (GRCm39) missense possibly damaging 0.88
R4406:Acaca UTSW 11 84,171,275 (GRCm39) missense probably benign 0.35
R4448:Acaca UTSW 11 84,153,318 (GRCm39) missense probably damaging 1.00
R4642:Acaca UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
R4696:Acaca UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
R4707:Acaca UTSW 11 84,203,680 (GRCm39) missense probably damaging 0.96
R4710:Acaca UTSW 11 84,283,163 (GRCm39) missense possibly damaging 0.84
R4775:Acaca UTSW 11 84,134,165 (GRCm39) missense probably damaging 1.00
R4821:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R4883:Acaca UTSW 11 84,142,116 (GRCm39) missense probably benign 0.01
R4988:Acaca UTSW 11 84,154,121 (GRCm39) missense probably damaging 1.00
R5034:Acaca UTSW 11 84,136,090 (GRCm39) missense probably benign 0.00
R5255:Acaca UTSW 11 84,202,133 (GRCm39) missense probably damaging 1.00
R5294:Acaca UTSW 11 84,282,345 (GRCm39) missense probably benign 0.01
R5350:Acaca UTSW 11 84,106,699 (GRCm39) missense probably damaging 0.99
R5437:Acaca UTSW 11 84,237,646 (GRCm39) splice site probably null
R5664:Acaca UTSW 11 84,134,210 (GRCm39) missense probably damaging 1.00
R5665:Acaca UTSW 11 84,136,120 (GRCm39) nonsense probably null
R5959:Acaca UTSW 11 84,106,792 (GRCm39) missense probably damaging 1.00
R6011:Acaca UTSW 11 84,136,570 (GRCm39) missense probably benign 0.44
R6027:Acaca UTSW 11 84,289,003 (GRCm39) missense probably benign
R6246:Acaca UTSW 11 84,206,796 (GRCm39) missense probably benign 0.08
R6313:Acaca UTSW 11 84,183,755 (GRCm39) missense probably benign 0.00
R6450:Acaca UTSW 11 84,171,294 (GRCm39) missense probably damaging 0.98
R6623:Acaca UTSW 11 84,262,325 (GRCm39) critical splice acceptor site probably null
R6736:Acaca UTSW 11 84,129,664 (GRCm39) missense probably benign 0.05
R6752:Acaca UTSW 11 84,086,309 (GRCm39) missense probably benign 0.44
R6807:Acaca UTSW 11 84,282,356 (GRCm39) missense probably benign
R6826:Acaca UTSW 11 84,086,362 (GRCm39) missense probably damaging 1.00
R7035:Acaca UTSW 11 84,129,769 (GRCm39) missense probably damaging 1.00
R7078:Acaca UTSW 11 84,154,138 (GRCm39) missense possibly damaging 0.91
R7088:Acaca UTSW 11 84,169,783 (GRCm39) critical splice donor site probably null
R7201:Acaca UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
R7261:Acaca UTSW 11 84,259,526 (GRCm39) missense probably damaging 1.00
R7399:Acaca UTSW 11 84,151,505 (GRCm39) missense possibly damaging 0.89
R7421:Acaca UTSW 11 84,254,562 (GRCm39) missense possibly damaging 0.64
R7443:Acaca UTSW 11 84,206,619 (GRCm39) missense probably benign 0.02
R7453:Acaca UTSW 11 84,136,136 (GRCm39) missense probably benign
R7471:Acaca UTSW 11 84,168,608 (GRCm39) splice site probably null
R7519:Acaca UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
R7537:Acaca UTSW 11 84,151,460 (GRCm39) missense probably damaging 1.00
R7574:Acaca UTSW 11 84,152,414 (GRCm39) missense probably benign
R7633:Acaca UTSW 11 84,263,465 (GRCm39) missense probably benign 0.26
R7643:Acaca UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
R7664:Acaca UTSW 11 84,136,175 (GRCm39) missense probably damaging 1.00
R7675:Acaca UTSW 11 84,206,742 (GRCm39) missense probably benign 0.04
R7676:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R7729:Acaca UTSW 11 84,262,339 (GRCm39) missense probably damaging 0.98
R7867:Acaca UTSW 11 84,140,350 (GRCm39) missense possibly damaging 0.88
R7898:Acaca UTSW 11 84,255,275 (GRCm39) critical splice donor site probably null
R7909:Acaca UTSW 11 84,136,061 (GRCm39) missense possibly damaging 0.56
R7915:Acaca UTSW 11 84,167,414 (GRCm39) missense probably benign
R7956:Acaca UTSW 11 84,211,406 (GRCm39) missense probably damaging 0.98
R8000:Acaca UTSW 11 84,283,057 (GRCm39) missense possibly damaging 0.88
R8038:Acaca UTSW 11 84,106,730 (GRCm39) missense probably damaging 1.00
R8545:Acaca UTSW 11 84,236,794 (GRCm39) missense probably damaging 1.00
R8722:Acaca UTSW 11 84,229,283 (GRCm39) missense possibly damaging 0.85
R9130:Acaca UTSW 11 84,202,145 (GRCm39) missense probably damaging 1.00
R9397:Acaca UTSW 11 84,259,551 (GRCm39) missense probably damaging 1.00
R9489:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9540:Acaca UTSW 11 84,134,237 (GRCm39) missense probably damaging 1.00
R9593:Acaca UTSW 11 84,271,339 (GRCm39) nonsense probably null
R9605:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9634:Acaca UTSW 11 84,184,816 (GRCm39) missense probably benign 0.00
R9720:Acaca UTSW 11 84,154,183 (GRCm39) missense probably damaging 1.00
RF014:Acaca UTSW 11 84,122,550 (GRCm39) missense probably benign 0.01
X0027:Acaca UTSW 11 84,183,721 (GRCm39) missense probably benign 0.01
X0060:Acaca UTSW 11 84,154,930 (GRCm39) missense probably benign
X0067:Acaca UTSW 11 84,259,563 (GRCm39) nonsense probably null
Z1176:Acaca UTSW 11 84,151,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCACATTTAACCCCAGAAG -3'
(R):5'- TTCTGCAATCGTTTCAGGCGG -3'

Sequencing Primer
(F):5'- TTTAACCCCAGAAGCATCAGC -3'
(R):5'- GCGGCTGCCACTCTTTC -3'
Posted On 2021-10-11