Incidental Mutation 'R9005:Dsc2'
ID 685258
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2b, Dsc2a
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20030633-20059554 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20038094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 616 (D616G)
Ref Sequence ENSEMBL: ENSMUSP00000042905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
AA Change: D616G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: D616G

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075214
AA Change: D616G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: D616G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331
AA Change: D15G

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,652,711 probably benign Het
Abcd4 C T 12: 84,608,582 W369* probably null Het
Abcf3 A G 16: 20,549,306 E98G probably benign Het
Acaca A T 11: 84,371,584 D2004V probably damaging Het
Acot5 G C 12: 84,069,856 M130I Het
Adamts3 C T 5: 89,677,834 E1049K probably benign Het
Agfg2 A T 5: 137,652,482 L456Q probably damaging Het
Agtr1b T A 3: 20,316,179 T88S possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd61 T A 5: 143,894,858 T43S probably benign Het
Apcs A G 1: 172,894,209 L190P probably benign Het
Arsg A G 11: 109,490,520 K30E probably benign Het
Banp A T 8: 121,978,702 M104L possibly damaging Het
BC048403 A G 10: 121,750,596 Y272C probably damaging Het
BC080695 G A 4: 143,571,855 D123N probably benign Het
Caskin1 A G 17: 24,499,137 Q268R probably benign Het
Ccdc112 A G 18: 46,296,388 V81A probably damaging Het
Cfap44 T C 16: 44,460,154 I1432T probably damaging Het
Chd2 A T 7: 73,484,546 N684K probably damaging Het
Creb1 T C 1: 64,566,319 probably null Het
Ctsc C T 7: 88,278,294 T31I probably damaging Het
Cttnbp2 C A 6: 18,434,431 R476L probably damaging Het
Cwf19l1 T C 19: 44,123,214 D260G possibly damaging Het
Cyp24a1 A T 2: 170,494,085 S211T probably damaging Het
Ddx3y T C Y: 1,282,919 N46D probably damaging Het
Dgkz G T 2: 91,938,745 H653Q probably benign Het
Dnajc16 A T 4: 141,764,634 I626N possibly damaging Het
Dscam A T 16: 96,801,380 S621T probably damaging Het
Dst T A 1: 34,228,693 V3058E probably damaging Het
Ep400 A T 5: 110,711,093 C1125S unknown Het
Glyatl3 G A 17: 40,912,728 Q41* probably null Het
Gm7694 T G 1: 170,301,358 I201L probably damaging Het
Gnal C T 18: 67,088,759 R78* probably null Het
Gtf3c1 T C 7: 125,703,897 D122G probably benign Het
Htt G T 5: 34,817,751 D622Y possibly damaging Het
Igkv4-92 A G 6: 68,755,097 C98R probably benign Het
Incenp G A 19: 9,877,724 R608* probably null Het
Kif3c G A 12: 3,401,706 R679H probably damaging Het
Kng1 T A 16: 23,079,396 H515Q probably damaging Het
Lamb2 T C 9: 108,484,171 probably null Het
Malrd1 A T 2: 15,845,329 N1253I unknown Het
Map3k21 A T 8: 125,910,732 D19V Het
March2 G T 17: 33,696,233 P129Q probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a4d T A 19: 11,556,200 D148E possibly damaging Het
Myl4 A G 11: 104,577,558 D36G probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr206 A T 16: 59,345,566 I45N probably damaging Het
Olfr235 A G 19: 12,268,340 T37A probably benign Het
Olfr447 T C 6: 42,912,236 S238P probably damaging Het
Pard3 G A 8: 127,277,166 S123N probably damaging Het
Parp8 T C 13: 116,876,590 N638D probably benign Het
Pgpep1l A T 7: 68,237,658 S65T probably damaging Het
Ppp1r13b A G 12: 111,830,274 V1068A probably benign Het
Prkd1 G A 12: 50,383,402 Q641* probably null Het
Ptgr2 T C 12: 84,298,099 V82A possibly damaging Het
Rbm34 G A 8: 126,959,582 P225S possibly damaging Het
Rnps1 A T 17: 24,418,522 K46I unknown Het
Shank1 T C 7: 44,352,985 V1376A probably benign Het
Ski A T 4: 155,221,860 Y221N probably damaging Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slit2 G A 5: 48,302,518 C1380Y possibly damaging Het
Smpd3 C T 8: 106,257,426 G554S probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Spdl1 C A 11: 34,809,708 C605F possibly damaging Het
Syne1 C A 10: 5,205,406 D5568Y probably benign Het
Tac1 C A 6: 7,559,141 A111D possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnfrsf1a T C 6: 125,356,915 C44R probably damaging Het
Traf3ip3 T C 1: 193,181,977 Q366R probably benign Het
Trip10 A G 17: 57,262,416 D479G probably damaging Het
Trip11 T C 12: 101,878,872 T1536A probably benign Het
Tstd3 G T 4: 21,767,082 A13E possibly damaging Het
Urb1 T C 16: 90,753,790 K2058R probably benign Het
Usp15 A T 10: 123,146,798 I304N possibly damaging Het
Usp18 T G 6: 121,252,570 H49Q probably benign Het
Vmn1r56 T A 7: 5,196,390 D76V probably damaging Het
Wnk1 A G 6: 119,962,432 S167P probably damaging Het
Zfp229 G A 17: 21,746,750 A654T possibly damaging Het
Zfp977 C T 7: 42,580,658 V148I probably benign Het
Znfx1 A T 2: 167,038,736 I1240N Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20034665 nonsense probably null
R9017:Dsc2 UTSW 18 20043911 missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20034707 missense probably benign 0.00
R9396:Dsc2 UTSW 18 20041716 nonsense probably null
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTCACTGACCATTATACC -3'
(R):5'- ACTGGAACTCTGGGAATCATAC -3'

Sequencing Primer
(F):5'- cacacacacagagagaga -3'
(R):5'- CTCTGGGAATCATACTTGAAGATGTG -3'
Posted On 2021-10-11