Incidental Mutation 'R9006:Abcc6'
ID 685294
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock # R9006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46016396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 267 (N267D)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: N267D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: N267D

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,273,519 F1182L possibly damaging Het
Akap1 A T 11: 88,833,170 M803K possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd31 T C 13: 96,830,596 F528L probably benign Het
Arhgef10l A G 4: 140,544,348 Y624H probably benign Het
Armc4 A T 18: 7,294,516 N32K probably benign Het
Cfap73 G A 5: 120,629,695 Q264* probably null Het
Clca2 C A 3: 145,078,028 A609S probably damaging Het
Cntfr A T 4: 41,661,971 probably null Het
Cyp2c65 C T 19: 39,082,270 T299I probably damaging Het
Cyp2j5 G T 4: 96,663,912 N33K probably benign Het
Dhcr7 T A 7: 143,841,241 S165T probably benign Het
Dnah10 A T 5: 124,743,719 D539V probably benign Het
Ebag9 A T 15: 44,640,307 Q176L probably benign Het
Ftmt A G 18: 52,332,040 K143E possibly damaging Het
Gcc2 C T 10: 58,267,979 R76C probably damaging Het
Gcn1l1 A G 5: 115,581,507 T354A probably benign Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Gm906 G A 13: 50,247,553 H246Y possibly damaging Het
Gtf2h1 A G 7: 46,808,838 M271V probably benign Het
Iah1 G A 12: 21,317,401 G36D probably damaging Het
Ism2 G T 12: 87,280,195 D323E probably damaging Het
Itih4 A G 14: 30,890,129 I184V probably damaging Het
Kdm4d C A 9: 14,463,537 V342L probably benign Het
Lmbr1 A G 5: 29,346,902 F62L probably benign Het
Lmo7 TCGGATTCTGTGGC TC 14: 101,917,636 probably benign Het
Lypd8 T A 11: 58,386,760 S123T possibly damaging Het
Micalcl T A 7: 112,382,116 N432K probably benign Het
Mrgprb4 A G 7: 48,198,595 V195A probably benign Het
Ms4a4c A T 19: 11,418,996 I106F probably benign Het
Myo6 A G 9: 80,228,858 T88A unknown Het
Naa35 A G 13: 59,601,028 D158G possibly damaging Het
Nol12 A G 15: 78,940,091 E137G possibly damaging Het
Nsun4 A G 4: 116,040,119 S232P probably damaging Het
Odam A T 5: 87,892,439 I255L probably benign Het
Olfr1270 T G 2: 90,149,983 T8P probably damaging Het
Olfr136 T C 17: 38,335,832 V225A possibly damaging Het
Olfr317 G A 11: 58,732,362 Q268* probably null Het
Olfr385 T A 11: 73,589,210 H176L probably benign Het
Olfr51 A T 11: 51,007,148 M59L probably damaging Het
Olfr761 A T 17: 37,952,654 Y123* probably null Het
Pcnx2 T C 8: 125,887,257 D485G probably benign Het
Polr3b T A 10: 84,631,833 N92K probably benign Het
Rpgrip1l T A 8: 91,280,808 M385L probably benign Het
Sdk1 A T 5: 141,937,566 N314I probably damaging Het
Slc45a1 A C 4: 150,638,274 C384W probably damaging Het
Slc4a11 C T 2: 130,690,853 V227M probably damaging Het
Sorbs2 A C 8: 45,805,821 S1132R possibly damaging Het
Spta1 T A 1: 174,219,971 I1727K probably damaging Het
Srgap2 T C 1: 131,355,569 E258G probably damaging Het
Taco1 A T 11: 106,066,105 probably benign Het
Taf2 A T 15: 55,045,905 M648K possibly damaging Het
Taf7 A G 18: 37,642,704 V270A probably benign Het
Tbkbp1 G A 11: 97,138,881 T483I unknown Het
Tesc A G 5: 118,046,313 probably null Het
Tgs1 A G 4: 3,595,427 N532S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem196 T A 12: 120,014,775 C84S probably damaging Het
Topbp1 C T 9: 103,305,300 probably benign Het
Ttc16 A G 2: 32,762,973 S615P probably benign Het
Tuba3b T C 6: 145,619,838 V344A possibly damaging Het
Tubgcp4 T C 2: 121,184,770 F320L probably benign Het
Tusc3 T A 8: 39,071,473 L222* probably null Het
Ubr4 G A 4: 139,444,692 probably null Het
Uncx G T 5: 139,547,181 V334L possibly damaging Het
Vezf1 C A 11: 88,074,716 F261L probably damaging Het
Vezt T A 10: 93,974,012 I556L probably benign Het
Vmn1r172 C T 7: 23,659,977 R96C probably benign Het
Zfp383 A G 7: 29,908,645 M1V probably null Het
Zfp558 A T 9: 18,456,480 S337R possibly damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTCAGCTGATGAGTGCTCTAG -3'
(R):5'- TACTGCCTTCAGGACCTAGCAG -3'

Sequencing Primer
(F):5'- CTAGAGGCCAGCTGATGAATGTTC -3'
(R):5'- TAGCAGAGGTGGCTTCCCAG -3'
Posted On 2021-10-11