Incidental Mutation 'R9006:Polr3b'
ID 685308
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84631833 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 92 (N92K)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably benign
Transcript: ENSMUST00000077175
AA Change: N92K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: N92K

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,273,519 F1182L possibly damaging Het
Abcc6 T C 7: 46,016,396 N267D probably benign Het
Akap1 A T 11: 88,833,170 M803K possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd31 T C 13: 96,830,596 F528L probably benign Het
Arhgef10l A G 4: 140,544,348 Y624H probably benign Het
Armc4 A T 18: 7,294,516 N32K probably benign Het
Cfap73 G A 5: 120,629,695 Q264* probably null Het
Clca2 C A 3: 145,078,028 A609S probably damaging Het
Cntfr A T 4: 41,661,971 probably null Het
Cyp2c65 C T 19: 39,082,270 T299I probably damaging Het
Cyp2j5 G T 4: 96,663,912 N33K probably benign Het
Dhcr7 T A 7: 143,841,241 S165T probably benign Het
Dnah10 A T 5: 124,743,719 D539V probably benign Het
Ebag9 A T 15: 44,640,307 Q176L probably benign Het
Ftmt A G 18: 52,332,040 K143E possibly damaging Het
Gcc2 C T 10: 58,267,979 R76C probably damaging Het
Gcn1l1 A G 5: 115,581,507 T354A probably benign Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Gm906 G A 13: 50,247,553 H246Y possibly damaging Het
Gtf2h1 A G 7: 46,808,838 M271V probably benign Het
Iah1 G A 12: 21,317,401 G36D probably damaging Het
Ism2 G T 12: 87,280,195 D323E probably damaging Het
Itih4 A G 14: 30,890,129 I184V probably damaging Het
Kdm4d C A 9: 14,463,537 V342L probably benign Het
Lmbr1 A G 5: 29,346,902 F62L probably benign Het
Lmo7 TCGGATTCTGTGGC TC 14: 101,917,636 probably benign Het
Lypd8 T A 11: 58,386,760 S123T possibly damaging Het
Micalcl T A 7: 112,382,116 N432K probably benign Het
Mrgprb4 A G 7: 48,198,595 V195A probably benign Het
Ms4a4c A T 19: 11,418,996 I106F probably benign Het
Myo6 A G 9: 80,228,858 T88A unknown Het
Naa35 A G 13: 59,601,028 D158G possibly damaging Het
Nol12 A G 15: 78,940,091 E137G possibly damaging Het
Nsun4 A G 4: 116,040,119 S232P probably damaging Het
Odam A T 5: 87,892,439 I255L probably benign Het
Olfr1270 T G 2: 90,149,983 T8P probably damaging Het
Olfr136 T C 17: 38,335,832 V225A possibly damaging Het
Olfr317 G A 11: 58,732,362 Q268* probably null Het
Olfr385 T A 11: 73,589,210 H176L probably benign Het
Olfr51 A T 11: 51,007,148 M59L probably damaging Het
Olfr761 A T 17: 37,952,654 Y123* probably null Het
Pcnx2 T C 8: 125,887,257 D485G probably benign Het
Rpgrip1l T A 8: 91,280,808 M385L probably benign Het
Sdk1 A T 5: 141,937,566 N314I probably damaging Het
Slc45a1 A C 4: 150,638,274 C384W probably damaging Het
Slc4a11 C T 2: 130,690,853 V227M probably damaging Het
Sorbs2 A C 8: 45,805,821 S1132R possibly damaging Het
Spta1 T A 1: 174,219,971 I1727K probably damaging Het
Srgap2 T C 1: 131,355,569 E258G probably damaging Het
Taco1 A T 11: 106,066,105 probably benign Het
Taf2 A T 15: 55,045,905 M648K possibly damaging Het
Taf7 A G 18: 37,642,704 V270A probably benign Het
Tbkbp1 G A 11: 97,138,881 T483I unknown Het
Tesc A G 5: 118,046,313 probably null Het
Tgs1 A G 4: 3,595,427 N532S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem196 T A 12: 120,014,775 C84S probably damaging Het
Topbp1 C T 9: 103,305,300 probably benign Het
Ttc16 A G 2: 32,762,973 S615P probably benign Het
Tuba3b T C 6: 145,619,838 V344A possibly damaging Het
Tubgcp4 T C 2: 121,184,770 F320L probably benign Het
Tusc3 T A 8: 39,071,473 L222* probably null Het
Ubr4 G A 4: 139,444,692 probably null Het
Uncx G T 5: 139,547,181 V334L possibly damaging Het
Vezf1 C A 11: 88,074,716 F261L probably damaging Het
Vezt T A 10: 93,974,012 I556L probably benign Het
Vmn1r172 C T 7: 23,659,977 R96C probably benign Het
Zfp383 A G 7: 29,908,645 M1V probably null Het
Zfp558 A T 9: 18,456,480 S337R possibly damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGAACTGTCACTTCAAGAAGGTAG -3'
(R):5'- ACAACAGGGTCTGAGATTTTCAAG -3'

Sequencing Primer
(F):5'- TGTCACTTCAAGAAGGTAGATAATTG -3'
(R):5'- GTATACAGCAAGCACAGAC -3'
Posted On 2021-10-11