Incidental Mutation 'R9006:Cyp2c65'
ID685337
Institutional Source Beutler Lab
Gene Symbol Cyp2c65
Ensembl Gene ENSMUSG00000067231
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R9006 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39061015-39093944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39082270 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 299 (T299I)
Ref Sequence ENSEMBL: ENSMUSP00000084489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087236]
Predicted Effect probably damaging
Transcript: ENSMUST00000087236
AA Change: T299I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084489
Gene: ENSMUSG00000067231
AA Change: T299I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-160 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,273,519 F1182L possibly damaging Het
Abcc6 T C 7: 46,016,396 N267D probably benign Het
Akap1 A T 11: 88,833,170 M803K possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd31 T C 13: 96,830,596 F528L probably benign Het
Arhgef10l A G 4: 140,544,348 Y624H probably benign Het
Armc4 A T 18: 7,294,516 N32K probably benign Het
Cfap73 G A 5: 120,629,695 Q264* probably null Het
Clca2 C A 3: 145,078,028 A609S probably damaging Het
Cntfr A T 4: 41,661,971 probably null Het
Cyp2j5 G T 4: 96,663,912 N33K probably benign Het
Dhcr7 T A 7: 143,841,241 S165T probably benign Het
Dnah10 A T 5: 124,743,719 D539V probably benign Het
Ebag9 A T 15: 44,640,307 Q176L probably benign Het
Ftmt A G 18: 52,332,040 K143E possibly damaging Het
Gcc2 C T 10: 58,267,979 R76C probably damaging Het
Gcn1l1 A G 5: 115,581,507 T354A probably benign Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Gm906 G A 13: 50,247,553 H246Y possibly damaging Het
Gtf2h1 A G 7: 46,808,838 M271V probably benign Het
Iah1 G A 12: 21,317,401 G36D probably damaging Het
Ism2 G T 12: 87,280,195 D323E probably damaging Het
Itih4 A G 14: 30,890,129 I184V probably damaging Het
Kdm4d C A 9: 14,463,537 V342L probably benign Het
Lmbr1 A G 5: 29,346,902 F62L probably benign Het
Lmo7 TCGGATTCTGTGGC TC 14: 101,917,636 probably benign Het
Lypd8 T A 11: 58,386,760 S123T possibly damaging Het
Micalcl T A 7: 112,382,116 N432K probably benign Het
Mrgprb4 A G 7: 48,198,595 V195A probably benign Het
Ms4a4c A T 19: 11,418,996 I106F probably benign Het
Myo6 A G 9: 80,228,858 T88A unknown Het
Naa35 A G 13: 59,601,028 D158G possibly damaging Het
Nol12 A G 15: 78,940,091 E137G possibly damaging Het
Nsun4 A G 4: 116,040,119 S232P probably damaging Het
Odam A T 5: 87,892,439 I255L probably benign Het
Olfr1270 T G 2: 90,149,983 T8P probably damaging Het
Olfr136 T C 17: 38,335,832 V225A possibly damaging Het
Olfr317 G A 11: 58,732,362 Q268* probably null Het
Olfr385 T A 11: 73,589,210 H176L probably benign Het
Olfr51 A T 11: 51,007,148 M59L probably damaging Het
Olfr761 A T 17: 37,952,654 Y123* probably null Het
Pcnx2 T C 8: 125,887,257 D485G probably benign Het
Polr3b T A 10: 84,631,833 N92K probably benign Het
Rpgrip1l T A 8: 91,280,808 M385L probably benign Het
Sdk1 A T 5: 141,937,566 N314I probably damaging Het
Slc45a1 A C 4: 150,638,274 C384W probably damaging Het
Slc4a11 C T 2: 130,690,853 V227M probably damaging Het
Sorbs2 A C 8: 45,805,821 S1132R possibly damaging Het
Spta1 T A 1: 174,219,971 I1727K probably damaging Het
Srgap2 T C 1: 131,355,569 E258G probably damaging Het
Taco1 A T 11: 106,066,105 probably benign Het
Taf2 A T 15: 55,045,905 M648K possibly damaging Het
Taf7 A G 18: 37,642,704 V270A probably benign Het
Tbkbp1 G A 11: 97,138,881 T483I unknown Het
Tesc A G 5: 118,046,313 probably null Het
Tgs1 A G 4: 3,595,427 N532S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem196 T A 12: 120,014,775 C84S probably damaging Het
Topbp1 C T 9: 103,305,300 probably benign Het
Ttc16 A G 2: 32,762,973 S615P probably benign Het
Tuba3b T C 6: 145,619,838 V344A possibly damaging Het
Tubgcp4 T C 2: 121,184,770 F320L probably benign Het
Tusc3 T A 8: 39,071,473 L222* probably null Het
Ubr4 G A 4: 139,444,692 probably null Het
Uncx G T 5: 139,547,181 V334L possibly damaging Het
Vezf1 C A 11: 88,074,716 F261L probably damaging Het
Vezt T A 10: 93,974,012 I556L probably benign Het
Vmn1r172 C T 7: 23,659,977 R96C probably benign Het
Zfp383 A G 7: 29,908,645 M1V probably null Het
Zfp558 A T 9: 18,456,480 S337R possibly damaging Het
Other mutations in Cyp2c65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Cyp2c65 APN 19 39072177 critical splice acceptor site probably null
IGL01124:Cyp2c65 APN 19 39093510 utr 3 prime probably benign
IGL01895:Cyp2c65 APN 19 39072232 missense possibly damaging 0.90
IGL02544:Cyp2c65 APN 19 39090638 missense probably damaging 1.00
R0172:Cyp2c65 UTSW 19 39087656 missense possibly damaging 0.86
R0378:Cyp2c65 UTSW 19 39073218 missense probably benign 0.19
R0517:Cyp2c65 UTSW 19 39082348 splice site probably benign
R0585:Cyp2c65 UTSW 19 39069242 missense probably benign 0.00
R1770:Cyp2c65 UTSW 19 39082198 missense probably benign 0.07
R2051:Cyp2c65 UTSW 19 39082231 missense probably benign 0.12
R2310:Cyp2c65 UTSW 19 39093382 missense probably benign 0.02
R2911:Cyp2c65 UTSW 19 39087682 missense probably damaging 0.96
R4208:Cyp2c65 UTSW 19 39090655 missense probably damaging 1.00
R4258:Cyp2c65 UTSW 19 39093428 missense probably benign 0.41
R4734:Cyp2c65 UTSW 19 39072334 missense probably benign 0.00
R4821:Cyp2c65 UTSW 19 39072191 missense probably damaging 1.00
R4926:Cyp2c65 UTSW 19 39061153 missense probably benign 0.00
R5060:Cyp2c65 UTSW 19 39061070 missense unknown
R5091:Cyp2c65 UTSW 19 39087565 critical splice acceptor site probably null
R5433:Cyp2c65 UTSW 19 39093484 missense probably benign 0.00
R6051:Cyp2c65 UTSW 19 39061166 missense probably benign 0.29
R6182:Cyp2c65 UTSW 19 39061162 missense probably benign 0.18
R6400:Cyp2c65 UTSW 19 39061114 missense possibly damaging 0.80
R6586:Cyp2c65 UTSW 19 39082218 missense possibly damaging 0.89
R6672:Cyp2c65 UTSW 19 39087674 missense probably damaging 1.00
R6850:Cyp2c65 UTSW 19 39069091 missense probably benign 0.15
R8075:Cyp2c65 UTSW 19 39072238 missense probably benign 0.10
R8756:Cyp2c65 UTSW 19 39061108 nonsense probably null
R9031:Cyp2c65 UTSW 19 39073219 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAGGTTTGTCAGGTCGAAC -3'
(R):5'- AAGATACCTTACTTGGGTCCTACTG -3'

Sequencing Primer
(F):5'- CCAAGGTTTGTCAGGTCGAACTTATC -3'
(R):5'- TATAGCAGATTGTAGTGCCACAAAAG -3'
Posted On2021-10-11