Incidental Mutation 'R9007:Atp6v0a4'
ID 685360
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms V-ATPase alpha 4, Atp6n1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9007 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 38048483-38124586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38053053 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 692 (K692R)
Ref Sequence ENSEMBL: ENSMUSP00000039381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]
AlphaFold Q920R6
Predicted Effect probably benign
Transcript: ENSMUST00000040259
AA Change: K692R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: K692R

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114908
AA Change: K692R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: K692R

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,103 C497S probably benign Het
3632451O06Rik T A 14: 49,774,238 D4V probably damaging Het
4930453N24Rik A T 16: 64,769,014 Y92* probably null Het
Adam3 A G 8: 24,715,111 V117A probably benign Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Atp8b1 A G 18: 64,551,860 V730A probably benign Het
Bdh2 T C 3: 135,285,548 probably benign Het
Ccnd3 T A 17: 47,594,407 probably null Het
Chrm4 T C 2: 91,927,730 V161A possibly damaging Het
Csmd3 T C 15: 47,888,496 probably benign Het
D430041D05Rik A G 2: 104,257,585 S349P probably benign Het
Ddx55 A G 5: 124,559,307 N244S probably damaging Het
Dock1 A G 7: 134,899,096 probably benign Het
Dppa3 T C 6: 122,628,765 S93P probably damaging Het
Echdc1 T C 10: 29,344,430 I217T probably damaging Het
Fpr-rs4 T A 17: 18,022,154 L141Q probably damaging Het
Galnt15 T C 14: 32,049,978 F451L probably damaging Het
Galnt9 G A 5: 110,544,799 R33H probably benign Het
Gm11361 A G 13: 28,257,889 N85S probably damaging Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Iah1 G A 12: 21,317,401 G36D probably damaging Het
Jakmip1 A G 5: 37,175,513 D1179G probably benign Het
Kcnh1 A G 1: 192,505,747 T866A probably benign Het
Kcnq4 T A 4: 120,697,953 I678F probably benign Het
Lars2 A T 9: 123,431,915 R384* probably null Het
Lman2 T C 13: 55,352,960 D142G probably damaging Het
Lrp1b T C 2: 40,697,552 D3897G Het
Lrrn1 T A 6: 107,567,859 I206N probably damaging Het
Mapkbp1 T A 2: 120,019,662 L802H probably damaging Het
Meaf6 T C 4: 125,107,657 probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mis18bp1 G A 12: 65,133,842 S955L probably benign Het
Mocs1 T A 17: 49,449,791 M267K probably damaging Het
Mroh3 T A 1: 136,200,372 Y263F probably damaging Het
Ndufs1 A T 1: 63,159,719 probably benign Het
Nuak1 T C 10: 84,374,628 Y532C probably damaging Het
Olfr65 A G 7: 103,906,958 H170R Het
Olfr775 A T 10: 129,250,800 T89S possibly damaging Het
Ost4 A G 5: 30,907,522 V5A possibly damaging Het
P2rx1 T A 11: 73,009,233 C159S probably damaging Het
Paqr8 T C 1: 20,935,390 L256P possibly damaging Het
Pgls T A 8: 71,596,045 probably benign Het
Pkd2l1 T C 19: 44,152,425 E566G possibly damaging Het
Plau A T 14: 20,839,545 H226L probably damaging Het
Rraga T C 4: 86,576,438 S174P probably damaging Het
Sacs T A 14: 61,207,736 D2410E probably benign Het
Sgms1 A T 19: 32,159,827 M113K probably benign Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Sqor T A 2: 122,807,956 Y373* probably null Het
Stra6l T A 4: 45,864,910 S79T possibly damaging Het
Svep1 T C 4: 58,091,915 I1573M possibly damaging Het
Syne2 A G 12: 76,099,450 D1674G possibly damaging Het
Tex26 C A 5: 149,453,419 T91N probably damaging Het
Tigd2 T G 6: 59,210,902 S251R probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnks1bp1 T A 2: 85,070,704 L1585Q probably damaging Het
Trmt10c A G 16: 56,035,179 V31A probably benign Het
Ttc41 T C 10: 86,733,761 S668P probably damaging Het
Uggt2 A T 14: 119,089,312 D162E probably damaging Het
Vmn1r125 G C 7: 21,272,578 V134L probably benign Het
Vmn1r225 T A 17: 20,503,187 F297I probably damaging Het
Vps13c A G 9: 67,937,724 D2030G probably benign Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
R8683:Atp6v0a4 UTSW 6 38048991 makesense probably null
R9359:Atp6v0a4 UTSW 6 38082113 missense probably benign 0.21
R9475:Atp6v0a4 UTSW 6 38060982 missense probably damaging 1.00
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTAGCCTGTGCCTGAGTTC -3'
(R):5'- TACCTAGCTGACATTGAGTGAGG -3'

Sequencing Primer
(F):5'- CCTGAGTTCATTCAGACAGGATG -3'
(R):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
Posted On 2021-10-11