Incidental Mutation 'R9007:Ttc41'
ID 685371
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R9007 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86733761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 668 (S668P)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075632
AA Change: S668P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: S668P

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,103 C497S probably benign Het
3632451O06Rik T A 14: 49,774,238 D4V probably damaging Het
4930453N24Rik A T 16: 64,769,014 Y92* probably null Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Atp6v0a4 T C 6: 38,053,053 K692R probably benign Het
Atp8b1 A G 18: 64,551,860 V730A probably benign Het
Bdh2 T C 3: 135,285,548 probably benign Het
Ccnd3 T A 17: 47,594,407 probably null Het
Chrm4 T C 2: 91,927,730 V161A possibly damaging Het
D430041D05Rik A G 2: 104,257,585 S349P probably benign Het
Ddx55 A G 5: 124,559,307 N244S probably damaging Het
Dppa3 T C 6: 122,628,765 S93P probably damaging Het
Echdc1 T C 10: 29,344,430 I217T probably damaging Het
Fpr-rs4 T A 17: 18,022,154 L141Q probably damaging Het
Galnt15 T C 14: 32,049,978 F451L probably damaging Het
Galnt9 G A 5: 110,544,799 R33H probably benign Het
Gm11361 A G 13: 28,257,889 N85S probably damaging Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Iah1 G A 12: 21,317,401 G36D probably damaging Het
Jakmip1 A G 5: 37,175,513 D1179G probably benign Het
Kcnh1 A G 1: 192,505,747 T866A probably benign Het
Kcnq4 T A 4: 120,697,953 I678F probably benign Het
Lars2 A T 9: 123,431,915 R384* probably null Het
Lman2 T C 13: 55,352,960 D142G probably damaging Het
Lrp1b T C 2: 40,697,552 D3897G Het
Lrrn1 T A 6: 107,567,859 I206N probably damaging Het
Mapkbp1 T A 2: 120,019,662 L802H probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mis18bp1 G A 12: 65,133,842 S955L probably benign Het
Mocs1 T A 17: 49,449,791 M267K probably damaging Het
Mroh3 T A 1: 136,200,372 Y263F probably damaging Het
Nuak1 T C 10: 84,374,628 Y532C probably damaging Het
Olfr65 A G 7: 103,906,958 H170R Het
Olfr775 A T 10: 129,250,800 T89S possibly damaging Het
Ost4 A G 5: 30,907,522 V5A possibly damaging Het
P2rx1 T A 11: 73,009,233 C159S probably damaging Het
Paqr8 T C 1: 20,935,390 L256P possibly damaging Het
Pkd2l1 T C 19: 44,152,425 E566G possibly damaging Het
Plau A T 14: 20,839,545 H226L probably damaging Het
Rraga T C 4: 86,576,438 S174P probably damaging Het
Sacs T A 14: 61,207,736 D2410E probably benign Het
Sgms1 A T 19: 32,159,827 M113K probably benign Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Sqor T A 2: 122,807,956 Y373* probably null Het
Stra6l T A 4: 45,864,910 S79T possibly damaging Het
Svep1 T C 4: 58,091,915 I1573M possibly damaging Het
Syne2 A G 12: 76,099,450 D1674G possibly damaging Het
Tex26 C A 5: 149,453,419 T91N probably damaging Het
Tigd2 T G 6: 59,210,902 S251R probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnks1bp1 T A 2: 85,070,704 L1585Q probably damaging Het
Trmt10c A G 16: 56,035,179 V31A probably benign Het
Uggt2 A T 14: 119,089,312 D162E probably damaging Het
Vmn1r125 G C 7: 21,272,578 V134L probably benign Het
Vmn1r225 T A 17: 20,503,187 F297I probably damaging Het
Vps13c A G 9: 67,937,724 D2030G probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCCTGGTGTAGTGGACCC -3'
(R):5'- CCATAAAGGAATAACCCCTGGGG -3'

Sequencing Primer
(F):5'- GGTGTAGTGGACCCCCTACTTC -3'
(R):5'- GTGCTCAGCCACTGAAGTC -3'
Posted On 2021-10-11