Incidental Mutation 'R9007:Fpr-rs4'
ID 685388
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Name formyl peptide receptor, related sequence 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R9007 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18021733-18022704 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18022154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 141 (L141Q)
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
AlphaFold A4FUQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000095651
AA Change: L141Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062
AA Change: L141Q

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,103 C497S probably benign Het
3632451O06Rik T A 14: 49,774,238 D4V probably damaging Het
4930453N24Rik A T 16: 64,769,014 Y92* probably null Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Atp6v0a4 T C 6: 38,053,053 K692R probably benign Het
Atp8b1 A G 18: 64,551,860 V730A probably benign Het
Bdh2 T C 3: 135,285,548 probably benign Het
Ccnd3 T A 17: 47,594,407 probably null Het
Chrm4 T C 2: 91,927,730 V161A possibly damaging Het
D430041D05Rik A G 2: 104,257,585 S349P probably benign Het
Ddx55 A G 5: 124,559,307 N244S probably damaging Het
Dppa3 T C 6: 122,628,765 S93P probably damaging Het
Echdc1 T C 10: 29,344,430 I217T probably damaging Het
Galnt15 T C 14: 32,049,978 F451L probably damaging Het
Galnt9 G A 5: 110,544,799 R33H probably benign Het
Gm11361 A G 13: 28,257,889 N85S probably damaging Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Iah1 G A 12: 21,317,401 G36D probably damaging Het
Jakmip1 A G 5: 37,175,513 D1179G probably benign Het
Kcnh1 A G 1: 192,505,747 T866A probably benign Het
Kcnq4 T A 4: 120,697,953 I678F probably benign Het
Lars2 A T 9: 123,431,915 R384* probably null Het
Lman2 T C 13: 55,352,960 D142G probably damaging Het
Lrp1b T C 2: 40,697,552 D3897G Het
Lrrn1 T A 6: 107,567,859 I206N probably damaging Het
Mapkbp1 T A 2: 120,019,662 L802H probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mis18bp1 G A 12: 65,133,842 S955L probably benign Het
Mocs1 T A 17: 49,449,791 M267K probably damaging Het
Mroh3 T A 1: 136,200,372 Y263F probably damaging Het
Nuak1 T C 10: 84,374,628 Y532C probably damaging Het
Olfr65 A G 7: 103,906,958 H170R Het
Olfr775 A T 10: 129,250,800 T89S possibly damaging Het
Ost4 A G 5: 30,907,522 V5A possibly damaging Het
P2rx1 T A 11: 73,009,233 C159S probably damaging Het
Paqr8 T C 1: 20,935,390 L256P possibly damaging Het
Pkd2l1 T C 19: 44,152,425 E566G possibly damaging Het
Plau A T 14: 20,839,545 H226L probably damaging Het
Rraga T C 4: 86,576,438 S174P probably damaging Het
Sacs T A 14: 61,207,736 D2410E probably benign Het
Sgms1 A T 19: 32,159,827 M113K probably benign Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Sqor T A 2: 122,807,956 Y373* probably null Het
Stra6l T A 4: 45,864,910 S79T possibly damaging Het
Svep1 T C 4: 58,091,915 I1573M possibly damaging Het
Syne2 A G 12: 76,099,450 D1674G possibly damaging Het
Tex26 C A 5: 149,453,419 T91N probably damaging Het
Tigd2 T G 6: 59,210,902 S251R probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnks1bp1 T A 2: 85,070,704 L1585Q probably damaging Het
Trmt10c A G 16: 56,035,179 V31A probably benign Het
Ttc41 T C 10: 86,733,761 S668P probably damaging Het
Uggt2 A T 14: 119,089,312 D162E probably damaging Het
Vmn1r125 G C 7: 21,272,578 V134L probably benign Het
Vmn1r225 T A 17: 20,503,187 F297I probably damaging Het
Vps13c A G 9: 67,937,724 D2030G probably benign Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R0686:Fpr-rs4 UTSW 17 18022351 missense probably benign 0.05
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2043:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2093:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6076:Fpr-rs4 UTSW 17 18022055 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6639:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R6757:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R8703:Fpr-rs4 UTSW 17 18022070 missense probably damaging 0.99
R9318:Fpr-rs4 UTSW 17 18021955 missense probably benign
R9357:Fpr-rs4 UTSW 17 18021949 missense probably damaging 0.97
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CATCATCTCAATGGTCATGAGAGG -3'
(R):5'- AGACATGGGCATGCTGAATC -3'

Sequencing Primer
(F):5'- CATGAGAGGAAAATGGCTTTTTGG -3'
(R):5'- CATGGGCATGCTGAATCCAATAATG -3'
Posted On 2021-10-11