Incidental Mutation 'R9008:Hnrnpr'
ID 685421
Institutional Source Beutler Lab
Gene Symbol Hnrnpr
Ensembl Gene ENSMUSG00000066037
Gene Name heterogeneous nuclear ribonucleoprotein R
Synonyms hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9008 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 136310942-136359447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 136329426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 246 (N246Y)
Ref Sequence ENSEMBL: ENSMUSP00000101476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000125696] [ENSMUST00000131671] [ENSMUST00000134524] [ENSMUST00000145282] [ENSMUST00000148843]
AlphaFold Q8VHM5
Predicted Effect probably damaging
Transcript: ENSMUST00000084219
AA Change: N145Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: N145Y

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105850
AA Change: N246Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: N246Y

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125696
Predicted Effect probably damaging
Transcript: ENSMUST00000131671
AA Change: N145Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: N145Y

DomainStartEndE-ValueType
RRM 65 139 1.27e-16 SMART
RRM 146 223 9.42e-11 SMART
RRM 241 306 3.76e-19 SMART
low complexity region 318 327 N/A INTRINSIC
low complexity region 332 395 N/A INTRINSIC
low complexity region 398 426 N/A INTRINSIC
low complexity region 430 473 N/A INTRINSIC
low complexity region 503 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134524
AA Change: N246Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119666
Gene: ENSMUSG00000066037
AA Change: N246Y

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145282
Predicted Effect probably damaging
Transcript: ENSMUST00000148843
AA Change: N246Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: N246Y

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Meta Mutation Damage Score 0.1483 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T G 15: 98,588,612 S88A possibly damaging Het
4930504O13Rik T A 11: 58,447,383 E61V probably benign Het
Abcc4 A T 14: 118,611,750 S536R probably damaging Het
Acacb G A 5: 114,248,754 silent Het
Acsm1 T C 7: 119,659,102 Y473H probably benign Het
Adam30 T A 3: 98,162,718 C622* probably null Het
Adprhl2 C T 4: 126,316,839 V283M probably damaging Het
AI606181 G T 19: 41,593,593 R67S unknown Het
Btbd3 A G 2: 138,283,533 I212M probably benign Het
C1s1 C T 6: 124,532,540 probably null Het
C7 T A 15: 5,010,927 T539S Het
Cd5l A C 3: 87,368,665 D314A probably damaging Het
Celsr3 T A 9: 108,828,952 V878E possibly damaging Het
Cfap74 T C 4: 155,418,664 S38P Het
Chst2 C T 9: 95,406,294 probably benign Het
Deaf1 T C 7: 141,324,165 T103A probably damaging Het
Deup1 T A 9: 15,599,844 D213V probably damaging Het
Dhrs1 A G 14: 55,741,181 probably null Het
Dnah7a A G 1: 53,662,342 V218A possibly damaging Het
Dock7 G A 4: 98,945,211 Q1950* probably null Het
Ehf G A 2: 103,266,828 R283W Het
Elovl3 A T 19: 46,134,648 N221I possibly damaging Het
Gm11938 A T 11: 99,603,140 V43E probably damaging Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Hmcn1 T C 1: 150,755,044 probably benign Het
Hnf4g A G 3: 3,643,036 N115S probably benign Het
Itpka A G 2: 119,749,413 E211G probably damaging Het
Krt78 TAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA TAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA 15: 101,946,776 probably benign Het
Lcorl A T 5: 45,774,174 probably benign Het
Mgat5 T C 1: 127,479,571 I658T probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mov10 A G 3: 104,800,016 Y606H probably benign Het
Naa38 T G 11: 69,396,322 V76G probably damaging Het
Nelfe C A 17: 34,854,358 P290T possibly damaging Het
Nfil3 A T 13: 52,967,573 Y432N probably damaging Het
Nipbl T C 15: 8,327,124 K1593E probably damaging Het
Nlrc3 G C 16: 3,958,943 L56V possibly damaging Het
Nlrp1a A T 11: 71,123,909 F172I possibly damaging Het
Ntn4 T A 10: 93,733,604 probably benign Het
Nudt2 G A 4: 41,480,288 R57Q probably damaging Het
Obsl1 A C 1: 75,505,383 L281W probably benign Het
Olfm4 A T 14: 80,018,167 N250I unknown Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr165 T A 16: 19,407,423 I198F probably benign Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Olfr456 T C 6: 42,486,969 S75G probably damaging Het
Olfr469 A G 7: 107,823,421 I16T possibly damaging Het
Pappa A T 4: 65,156,189 T327S probably damaging Het
Pcdhb4 T G 18: 37,307,661 M8R probably benign Het
Phf21b T A 15: 84,787,362 I444F probably damaging Het
Pkd1l2 A C 8: 117,042,298 V1205G probably benign Het
Plec T C 15: 76,176,032 Y3235C probably damaging Het
Pnmt C T 11: 98,388,006 T266I possibly damaging Het
Ppfia2 T A 10: 106,819,359 D262E probably benign Het
Rabggta A T 14: 55,718,456 L448Q probably damaging Het
Rap1gds1 C T 3: 138,955,416 R449H probably benign Het
Rictor T A 15: 6,772,129 probably benign Het
Rttn T C 18: 89,009,432 F557S probably damaging Het
Ryr3 A G 2: 112,635,403 C4809R probably damaging Het
Sacs A C 14: 61,204,543 D1346A probably benign Het
Slain1 T A 14: 103,685,755 S261T probably damaging Het
Slc22a4 C T 11: 53,990,838 W351* probably null Het
Smpd3 C T 8: 106,257,426 G554S probably benign Het
Spag17 C T 3: 100,027,626 S716F possibly damaging Het
Spg11 C T 2: 122,069,932 M1546I probably benign Het
Stac3 C T 10: 127,503,585 L117F probably damaging Het
Surf6 A G 2: 26,892,524 W264R probably damaging Het
Taar7e T C 10: 24,037,912 V100A probably damaging Het
Tenm3 T C 8: 48,342,653 H534R probably damaging Het
Tinagl1 C A 4: 130,174,030 R57L probably damaging Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Traf6 A G 2: 101,696,988 Y361C possibly damaging Het
Ttn A T 2: 76,946,990 probably benign Het
Ufl1 A T 4: 25,254,778 Y559* probably null Het
Upk1b A T 16: 38,787,208 N52K probably damaging Het
Uqcrb A G 13: 66,905,299 S5P probably benign Het
Use1 A G 8: 71,367,044 Y3C unknown Het
Usp9y T A Y: 1,434,993 I279L possibly damaging Het
Vmn1r142 A G 7: 22,163,371 L222P probably damaging Het
Vmn1r184 A C 7: 26,267,752 N308H probably benign Het
Vmn2r14 C A 5: 109,220,027 M366I probably benign Het
Vmn2r73 G T 7: 85,872,696 S145Y probably damaging Het
Wdfy1 A T 1: 79,714,980 W207R probably damaging Het
Zbtb38 A T 9: 96,687,047 N661K probably benign Het
Zkscan3 G T 13: 21,388,213 H416Q possibly damaging Het
Other mutations in Hnrnpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Hnrnpr APN 4 136339545 missense unknown
IGL00844:Hnrnpr APN 4 136339205 missense probably benign 0.17
IGL01374:Hnrnpr APN 4 136327418 splice site probably benign
IGL01704:Hnrnpr APN 4 136329381 missense possibly damaging 0.89
IGL01825:Hnrnpr APN 4 136339539 nonsense probably null
IGL01843:Hnrnpr APN 4 136339413 splice site probably benign
IGL01871:Hnrnpr APN 4 136339574 missense unknown
IGL02376:Hnrnpr APN 4 136319455 missense probably damaging 1.00
IGL02557:Hnrnpr APN 4 136319506 missense probably damaging 1.00
IGL02947:Hnrnpr APN 4 136316379 missense probably damaging 1.00
PIT4677001:Hnrnpr UTSW 4 136329439 missense probably damaging 1.00
R0142:Hnrnpr UTSW 4 136327282 missense probably damaging 1.00
R0219:Hnrnpr UTSW 4 136339163 splice site probably benign
R1459:Hnrnpr UTSW 4 136329444 missense probably damaging 1.00
R1917:Hnrnpr UTSW 4 136332488 nonsense probably null
R2007:Hnrnpr UTSW 4 136319513 unclassified probably benign
R2364:Hnrnpr UTSW 4 136327329 missense possibly damaging 0.69
R3788:Hnrnpr UTSW 4 136336313 missense probably damaging 1.00
R4066:Hnrnpr UTSW 4 136339346 intron probably benign
R4232:Hnrnpr UTSW 4 136339189 missense probably benign 0.15
R4433:Hnrnpr UTSW 4 136317148 missense probably benign 0.04
R4664:Hnrnpr UTSW 4 136317175 unclassified probably benign
R4990:Hnrnpr UTSW 4 136329379 missense probably damaging 1.00
R4990:Hnrnpr UTSW 4 136336298 missense probably damaging 1.00
R5058:Hnrnpr UTSW 4 136336337 missense possibly damaging 0.89
R5328:Hnrnpr UTSW 4 136339216 missense probably benign 0.01
R5469:Hnrnpr UTSW 4 136319434 missense probably damaging 1.00
R5641:Hnrnpr UTSW 4 136332487 missense probably damaging 0.97
R7067:Hnrnpr UTSW 4 136327393 missense probably damaging 1.00
R7250:Hnrnpr UTSW 4 136332435 missense probably benign 0.45
R7254:Hnrnpr UTSW 4 136332575 missense possibly damaging 0.92
R8213:Hnrnpr UTSW 4 136317175 unclassified probably benign
R8942:Hnrnpr UTSW 4 136332480 missense possibly damaging 0.95
R9502:Hnrnpr UTSW 4 136329370 missense probably damaging 0.99
R9515:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
R9516:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCAAGTGTGAGGGAGC -3'
(R):5'- AAGCTTCCACTTGAGAGCTAG -3'

Sequencing Primer
(F):5'- CAAGTGTGAGGGAGCTTGGTG -3'
(R):5'- GCAACTGATACATAGGAAACTTGAAC -3'
Posted On 2021-10-11