Incidental Mutation 'R9009:Gpr158'
ID 685483
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene Name G protein-coupled receptor 158
Synonyms 5330427M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9009 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 21367542-21830547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21576949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 413 (D413V)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
AlphaFold Q8C419
Predicted Effect probably damaging
Transcript: ENSMUST00000055946
AA Change: D413V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: D413V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Meta Mutation Damage Score 0.1599 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (58/62)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik T A 8: 120,151,540 probably benign Het
Ahctf1 C T 1: 179,753,606 S1677N probably benign Het
Ank2 T C 3: 126,934,376 probably benign Het
Arid3c A T 4: 41,729,925 I90N probably benign Het
Asb1 C A 1: 91,552,483 D301E unknown Het
Asb1 T G 1: 91,552,484 *302G probably null Het
Birc2 A T 9: 7,833,936 F181L probably benign Het
Bnip1 T A 17: 26,782,616 probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd2ap T C 17: 42,805,244 D575G possibly damaging Het
Cdca7 T A 2: 72,483,929 H248Q probably damaging Het
Chd2 T C 7: 73,490,654 I609V probably benign Het
Chd2 T C 7: 73,493,444 D567G probably benign Het
Cnmd T A 14: 79,656,645 T101S probably damaging Het
Col6a4 T C 9: 106,077,205 T312A probably benign Het
Cript C A 17: 87,031,047 T41N probably damaging Het
Cts6 T C 13: 61,196,447 I264V probably benign Het
Cyp4a32 C T 4: 115,610,605 T262I probably null Het
D430041D05Rik T A 2: 104,410,176 probably benign Het
Dctd C T 8: 48,111,677 P5S probably benign Het
Det1 T C 7: 78,843,236 N340S probably benign Het
Dnah7b A G 1: 46,223,072 N2032D probably benign Het
Dscam T A 16: 97,038,916 T164S probably benign Het
Emcn T C 3: 137,419,014 V196A possibly damaging Het
Fbxo32 A G 15: 58,182,962 I284T possibly damaging Het
Gimap3 C A 6: 48,765,160 D279Y possibly damaging Het
Gm43302 C T 5: 105,280,108 D196N probably benign Het
Gpc6 C A 14: 117,186,805 H102N possibly damaging Het
Hrasls5 G T 19: 7,637,458 M228I probably benign Het
Ifi207 T C 1: 173,727,816 R767G probably damaging Het
Kcnip2 T C 19: 45,812,195 probably benign Het
Kifap3 A C 1: 163,868,722 D640A probably damaging Het
Lmbrd2 A T 15: 9,157,224 Q183L possibly damaging Het
Malt1 A G 18: 65,444,840 I135V probably benign Het
Mfhas1 T C 8: 35,589,955 V528A probably damaging Het
Mllt10 T C 2: 18,162,352 S363P probably damaging Het
Mrnip A G 11: 50,182,496 Y44C probably damaging Het
Mstn C T 1: 53,063,972 Q156* probably null Het
Mtmr7 T C 8: 40,555,863 D469G possibly damaging Het
Muc6 A G 7: 141,637,105 S2552P possibly damaging Het
Myo1f C A 17: 33,604,688 N1063K probably benign Het
Olfr1346 G A 7: 6,474,400 V97M probably benign Het
Olfr312 A T 11: 58,831,454 Y100F probably benign Het
Olfr552 T A 7: 102,604,435 I27N probably benign Het
Orai2 A G 5: 136,150,576 V201A possibly damaging Het
Pcdhga6 A T 18: 37,708,825 T533S possibly damaging Het
Pkd1l1 T A 11: 8,931,552 K907N Het
Ppp1r15a A T 7: 45,524,625 V253E probably benign Het
Ppp1r9b A G 11: 94,996,641 E493G probably benign Het
Prdm1 T C 10: 44,447,001 N151S probably benign Het
Prkcd C T 14: 30,607,340 A163T probably damaging Het
Prl7a2 T A 13: 27,666,011 E26V probably damaging Het
Ptprm A T 17: 66,689,359 N1278K probably damaging Het
Ptprz1 T A 6: 23,001,654 S1248T possibly damaging Het
Scn9a T C 2: 66,508,583 I1186M probably damaging Het
Sv2a T C 3: 96,187,093 F248S probably benign Het
Tas2r116 T A 6: 132,856,000 I188K probably damaging Het
Tcf21 T C 10: 22,817,772 T169A probably benign Het
Tecrl C A 5: 83,284,274 C258F probably damaging Het
Tet2 T A 3: 133,487,599 E358V possibly damaging Het
Thada A T 17: 84,451,775 S219T possibly damaging Het
Tpgs2 T A 18: 25,168,720 probably benign Het
Ttc6 A T 12: 57,697,433 I1284F probably damaging Het
Vmn1r160 T C 7: 22,871,702 V160A possibly damaging Het
Vmn1r44 T C 6: 89,893,689 L139P probably damaging Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
R8311:Gpr158 UTSW 2 21368890 missense probably benign 0.00
R8754:Gpr158 UTSW 2 21576882 missense probably benign 0.00
R8782:Gpr158 UTSW 2 21399338 missense probably damaging 1.00
R8792:Gpr158 UTSW 2 21553326 missense probably damaging 1.00
R8842:Gpr158 UTSW 2 21576940 missense possibly damaging 0.88
R9102:Gpr158 UTSW 2 21825267 missense probably damaging 1.00
R9150:Gpr158 UTSW 2 21826440 missense probably benign 0.17
R9254:Gpr158 UTSW 2 21368231 start gained probably benign
R9317:Gpr158 UTSW 2 21827226 missense probably benign
R9379:Gpr158 UTSW 2 21368231 start gained probably benign
R9428:Gpr158 UTSW 2 21783161 missense probably benign
R9497:Gpr158 UTSW 2 21827014 missense probably benign 0.00
R9667:Gpr158 UTSW 2 21825243 missense probably damaging 0.99
R9681:Gpr158 UTSW 2 21826504 missense probably damaging 0.99
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGTGAAGGTCTAACTCTCTTCTCTC -3'
(R):5'- CTCAACCAATCACATTGTAGGATG -3'

Sequencing Primer
(F):5'- TCTCTTCTCTCTCACTTACTTTAGAG -3'
(R):5'- GTATGTTTACTAGAACAGTAATGGGG -3'
Posted On 2021-10-11