Incidental Mutation 'R9009:Olfr552'
ID 685505
Institutional Source Beutler Lab
Gene Symbol Olfr552
Ensembl Gene ENSMUSG00000073973
Gene Name olfactory receptor 552
Synonyms GA_x6K02T2PBJ9-5323062-5324015, MOR28-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9009 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102597770-102608125 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102604435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 27 (I27N)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
AlphaFold E9Q545
Predicted Effect probably benign
Transcript: ENSMUST00000098223
AA Change: I27N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: I27N

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215712
AA Change: I27N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1341 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (58/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik T A 8: 120,151,540 probably benign Het
Ahctf1 C T 1: 179,753,606 S1677N probably benign Het
Ank2 T C 3: 126,934,376 probably benign Het
Arid3c A T 4: 41,729,925 I90N probably benign Het
Asb1 C A 1: 91,552,483 D301E unknown Het
Asb1 T G 1: 91,552,484 *302G probably null Het
Birc2 A T 9: 7,833,936 F181L probably benign Het
Bnip1 T A 17: 26,782,616 probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd2ap T C 17: 42,805,244 D575G possibly damaging Het
Cdca7 T A 2: 72,483,929 H248Q probably damaging Het
Chd2 T C 7: 73,490,654 I609V probably benign Het
Chd2 T C 7: 73,493,444 D567G probably benign Het
Cnmd T A 14: 79,656,645 T101S probably damaging Het
Col6a4 T C 9: 106,077,205 T312A probably benign Het
Cript C A 17: 87,031,047 T41N probably damaging Het
Cts6 T C 13: 61,196,447 I264V probably benign Het
Cyp4a32 C T 4: 115,610,605 T262I probably null Het
D430041D05Rik T A 2: 104,410,176 probably benign Het
Dctd C T 8: 48,111,677 P5S probably benign Het
Det1 T C 7: 78,843,236 N340S probably benign Het
Dnah7b A G 1: 46,223,072 N2032D probably benign Het
Dscam T A 16: 97,038,916 T164S probably benign Het
Emcn T C 3: 137,419,014 V196A possibly damaging Het
Fbxo32 A G 15: 58,182,962 I284T possibly damaging Het
Gimap3 C A 6: 48,765,160 D279Y possibly damaging Het
Gm43302 C T 5: 105,280,108 D196N probably benign Het
Gpc6 C A 14: 117,186,805 H102N possibly damaging Het
Gpr158 A T 2: 21,576,949 D413V probably damaging Het
Hrasls5 G T 19: 7,637,458 M228I probably benign Het
Ifi207 T C 1: 173,727,816 R767G probably damaging Het
Kcnip2 T C 19: 45,812,195 probably benign Het
Kifap3 A C 1: 163,868,722 D640A probably damaging Het
Lmbrd2 A T 15: 9,157,224 Q183L possibly damaging Het
Malt1 A G 18: 65,444,840 I135V probably benign Het
Mfhas1 T C 8: 35,589,955 V528A probably damaging Het
Mllt10 T C 2: 18,162,352 S363P probably damaging Het
Mrnip A G 11: 50,182,496 Y44C probably damaging Het
Mstn C T 1: 53,063,972 Q156* probably null Het
Mtmr7 T C 8: 40,555,863 D469G possibly damaging Het
Muc6 A G 7: 141,637,105 S2552P possibly damaging Het
Myo1f C A 17: 33,604,688 N1063K probably benign Het
Olfr1346 G A 7: 6,474,400 V97M probably benign Het
Olfr312 A T 11: 58,831,454 Y100F probably benign Het
Orai2 A G 5: 136,150,576 V201A possibly damaging Het
Pcdhga6 A T 18: 37,708,825 T533S possibly damaging Het
Pkd1l1 T A 11: 8,931,552 K907N Het
Ppp1r15a A T 7: 45,524,625 V253E probably benign Het
Ppp1r9b A G 11: 94,996,641 E493G probably benign Het
Prdm1 T C 10: 44,447,001 N151S probably benign Het
Prkcd C T 14: 30,607,340 A163T probably damaging Het
Prl7a2 T A 13: 27,666,011 E26V probably damaging Het
Ptprm A T 17: 66,689,359 N1278K probably damaging Het
Ptprz1 T A 6: 23,001,654 S1248T possibly damaging Het
Scn9a T C 2: 66,508,583 I1186M probably damaging Het
Sv2a T C 3: 96,187,093 F248S probably benign Het
Tas2r116 T A 6: 132,856,000 I188K probably damaging Het
Tcf21 T C 10: 22,817,772 T169A probably benign Het
Tecrl C A 5: 83,284,274 C258F probably damaging Het
Tet2 T A 3: 133,487,599 E358V possibly damaging Het
Thada A T 17: 84,451,775 S219T possibly damaging Het
Tpgs2 T A 18: 25,168,720 probably benign Het
Ttc6 A T 12: 57,697,433 I1284F probably damaging Het
Vmn1r160 T C 7: 22,871,702 V160A possibly damaging Het
Vmn1r44 T C 6: 89,893,689 L139P probably damaging Het
Other mutations in Olfr552
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr552 APN 7 102604357 start codon destroyed probably null 0.99
IGL03061:Olfr552 APN 7 102604739 missense probably damaging 0.99
R0989:Olfr552 UTSW 7 102604483 missense probably damaging 1.00
R1513:Olfr552 UTSW 7 102605302 missense probably benign 0.09
R1969:Olfr552 UTSW 7 102604570 missense probably damaging 0.99
R3177:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R3277:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R4019:Olfr552 UTSW 7 102604642 missense probably damaging 1.00
R4028:Olfr552 UTSW 7 102605293 missense possibly damaging 0.62
R5216:Olfr552 UTSW 7 102604821 missense probably benign 0.00
R5444:Olfr552 UTSW 7 102604869 nonsense probably null
R5461:Olfr552 UTSW 7 102604408 missense probably damaging 0.99
R7706:Olfr552 UTSW 7 102604646 missense probably benign 0.12
R8348:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8448:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8919:Olfr552 UTSW 7 102604504 missense probably damaging 1.00
R8933:Olfr552 UTSW 7 102604430 missense probably damaging 1.00
R9139:Olfr552 UTSW 7 102604978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGACAATAGGTGACTTTCTCTTG -3'
(R):5'- ACAGGGAGAGCATTTTGGGC -3'

Sequencing Primer
(F):5'- TATTTGAAGACTCACACAAGAGAAG -3'
(R):5'- AGAGCATTTTGGGCAGTGTTGAC -3'
Posted On 2021-10-11