Incidental Mutation 'R9009:Dscam'
ID 685527
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik
MMRRC Submission
Accession Numbers

Genbank: NM_031174; MGI: 1196281
Essential gene? Essential (E-score: 1.000) question?
Stock # R9009 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 96592079-97170752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 97038916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 164 (T164S)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: T164S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: T164S

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.1054 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (58/62)
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik T A 8: 120,151,540 probably benign Het
Ahctf1 C T 1: 179,753,606 S1677N probably benign Het
Ank2 T C 3: 126,934,376 probably benign Het
Arid3c A T 4: 41,729,925 I90N probably benign Het
Asb1 C A 1: 91,552,483 D301E unknown Het
Asb1 T G 1: 91,552,484 *302G probably null Het
Birc2 A T 9: 7,833,936 F181L probably benign Het
Bnip1 T A 17: 26,782,616 probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd2ap T C 17: 42,805,244 D575G possibly damaging Het
Cdca7 T A 2: 72,483,929 H248Q probably damaging Het
Chd2 T C 7: 73,490,654 I609V probably benign Het
Chd2 T C 7: 73,493,444 D567G probably benign Het
Cnmd T A 14: 79,656,645 T101S probably damaging Het
Col6a4 T C 9: 106,077,205 T312A probably benign Het
Cript C A 17: 87,031,047 T41N probably damaging Het
Cts6 T C 13: 61,196,447 I264V probably benign Het
Cyp4a32 C T 4: 115,610,605 T262I probably null Het
D430041D05Rik T A 2: 104,410,176 probably benign Het
Dctd C T 8: 48,111,677 P5S probably benign Het
Det1 T C 7: 78,843,236 N340S probably benign Het
Dnah7b A G 1: 46,223,072 N2032D probably benign Het
Emcn T C 3: 137,419,014 V196A possibly damaging Het
Fbxo32 A G 15: 58,182,962 I284T possibly damaging Het
Gimap3 C A 6: 48,765,160 D279Y possibly damaging Het
Gm43302 C T 5: 105,280,108 D196N probably benign Het
Gpc6 C A 14: 117,186,805 H102N possibly damaging Het
Gpr158 A T 2: 21,576,949 D413V probably damaging Het
Hrasls5 G T 19: 7,637,458 M228I probably benign Het
Ifi207 T C 1: 173,727,816 R767G probably damaging Het
Kcnip2 T C 19: 45,812,195 probably benign Het
Kifap3 A C 1: 163,868,722 D640A probably damaging Het
Lmbrd2 A T 15: 9,157,224 Q183L possibly damaging Het
Malt1 A G 18: 65,444,840 I135V probably benign Het
Mfhas1 T C 8: 35,589,955 V528A probably damaging Het
Mllt10 T C 2: 18,162,352 S363P probably damaging Het
Mrnip A G 11: 50,182,496 Y44C probably damaging Het
Mstn C T 1: 53,063,972 Q156* probably null Het
Mtmr7 T C 8: 40,555,863 D469G possibly damaging Het
Muc6 A G 7: 141,637,105 S2552P possibly damaging Het
Myo1f C A 17: 33,604,688 N1063K probably benign Het
Olfr1346 G A 7: 6,474,400 V97M probably benign Het
Olfr312 A T 11: 58,831,454 Y100F probably benign Het
Olfr552 T A 7: 102,604,435 I27N probably benign Het
Orai2 A G 5: 136,150,576 V201A possibly damaging Het
Pcdhga6 A T 18: 37,708,825 T533S possibly damaging Het
Pkd1l1 T A 11: 8,931,552 K907N Het
Ppp1r15a A T 7: 45,524,625 V253E probably benign Het
Ppp1r9b A G 11: 94,996,641 E493G probably benign Het
Prdm1 T C 10: 44,447,001 N151S probably benign Het
Prkcd C T 14: 30,607,340 A163T probably damaging Het
Prl7a2 T A 13: 27,666,011 E26V probably damaging Het
Ptprm A T 17: 66,689,359 N1278K probably damaging Het
Ptprz1 T A 6: 23,001,654 S1248T possibly damaging Het
Scn9a T C 2: 66,508,583 I1186M probably damaging Het
Sv2a T C 3: 96,187,093 F248S probably benign Het
Tas2r116 T A 6: 132,856,000 I188K probably damaging Het
Tcf21 T C 10: 22,817,772 T169A probably benign Het
Tecrl C A 5: 83,284,274 C258F probably damaging Het
Tet2 T A 3: 133,487,599 E358V possibly damaging Het
Thada A T 17: 84,451,775 S219T possibly damaging Het
Tpgs2 T A 18: 25,168,720 probably benign Het
Ttc6 A T 12: 57,697,433 I1284F probably damaging Het
Vmn1r160 T C 7: 22,871,702 V160A possibly damaging Het
Vmn1r44 T C 6: 89,893,689 L139P probably damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
growler UTSW 16 96820997 missense probably damaging 0.99
Twostep UTSW 16 96825782 splice site probably null
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 splice site probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 splice site probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R8108:Dscam UTSW 16 96643879 missense probably benign 0.01
R8128:Dscam UTSW 16 96801174 splice site probably null
R8770:Dscam UTSW 16 96654906 missense possibly damaging 0.50
R8876:Dscam UTSW 16 96619628 missense probably damaging 0.96
R9005:Dscam UTSW 16 96801380 missense probably damaging 1.00
R9168:Dscam UTSW 16 96619568 missense possibly damaging 0.82
R9176:Dscam UTSW 16 96685353 missense probably benign 0.37
R9244:Dscam UTSW 16 96685229 missense possibly damaging 0.62
R9339:Dscam UTSW 16 96716063 missense possibly damaging 0.89
R9374:Dscam UTSW 16 97056657 missense probably benign 0.19
R9385:Dscam UTSW 16 97039003 missense probably benign
R9674:Dscam UTSW 16 96640836 missense probably benign 0.03
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATGCCACCAGGAATATTTG -3'
(R):5'- TGTGCCATGCCTTGTTAGC -3'

Sequencing Primer
(F):5'- GCCACCAGGAATATTTGTAATATGG -3'
(R):5'- CAATATCTCCTTGGCCAGAATGGG -3'
Posted On 2021-10-11