Incidental Mutation 'R9010:Nusap1'
ID 685545
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Name nucleolar and spindle associated protein 1
Synonyms 2610201A12Rik, NuSAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9010 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119618298-119651244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119648975 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 424 (T424A)
Ref Sequence ENSEMBL: ENSMUSP00000068713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
AlphaFold Q9ERH4
Predicted Effect possibly damaging
Transcript: ENSMUST00000028771
AA Change: T391A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306
AA Change: T391A

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068225
AA Change: T424A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306
AA Change: T424A

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,971,645 M87K possibly damaging Het
4931406P16Rik A T 7: 34,239,066 C1015S probably benign Het
Akap2 A T 4: 57,883,192 D845V probably damaging Het
Angel1 T C 12: 86,723,379 S36G possibly damaging Het
Apol6 A G 15: 77,051,497 H322R unknown Het
Arfgef2 G A 2: 166,859,364 R694Q probably damaging Het
Bank1 A T 3: 136,055,798 N748K probably benign Het
Bptf A T 11: 107,073,750 D1539E probably damaging Het
Bst1 T C 5: 43,825,353 I180T possibly damaging Het
Cabin1 C A 10: 75,735,058 E795* probably null Het
Cckar T A 5: 53,699,821 T416S probably damaging Het
Ccng2 G T 5: 93,268,757 E46* probably null Het
Ceacam9 T C 7: 16,721,991 S8P probably benign Het
Cercam G A 2: 29,876,059 D317N possibly damaging Het
Cfap54 T A 10: 92,899,059 M2377L unknown Het
Cgnl1 A T 9: 71,651,349 L914H probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec2g T A 6: 128,948,725 F32L unknown Het
Cntnap5c A T 17: 58,364,164 M1116L probably benign Het
Col11a2 C A 17: 34,064,786 F1516L unknown Het
Crb2 A G 2: 37,790,686 E542G probably benign Het
Crisp1 A T 17: 40,305,210 probably benign Het
Crybg3 G A 16: 59,554,339 T470M probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Entpd3 T C 9: 120,555,759 I134T probably benign Het
Gm19410 A G 8: 35,814,857 M1865V probably benign Het
Gm8251 A G 1: 44,061,473 V155A possibly damaging Het
Gpat2 A G 2: 127,435,226 E728G probably benign Het
Heatr5b C A 17: 78,773,710 S1371I probably damaging Het
Ighv1-4 A T 12: 114,487,329 M53K possibly damaging Het
Itch A T 2: 155,179,071 T169S probably benign Het
Kifc2 A G 15: 76,666,685 N587S possibly damaging Het
Klk1b16 A T 7: 44,140,753 D149V probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lefty2 T A 1: 180,894,607 I170N probably damaging Het
Lrrc14b A G 13: 74,361,032 F419L possibly damaging Het
Mkrn2 T A 6: 115,614,622 V302E possibly damaging Het
Msh4 T C 3: 153,890,182 K271R probably benign Het
Muc6 T C 7: 141,640,084 T1559A unknown Het
Naa16 T G 14: 79,370,042 R289S probably benign Het
Nab1 T A 1: 52,490,451 I96F possibly damaging Het
Ntn4 T C 10: 93,644,644 C77R Het
Olfr1361 A G 13: 21,658,511 Y271H probably damaging Het
Olfr1509 T A 14: 52,451,099 S229T possibly damaging Het
Olfr59 G T 11: 74,289,479 V278F probably damaging Het
Otog A G 7: 46,300,470 D267G probably benign Het
P2ry2 A C 7: 100,998,151 F316V probably benign Het
Padi2 A G 4: 140,936,613 T426A probably damaging Het
Plxna2 T C 1: 194,788,909 F996S possibly damaging Het
Ppp4r3a T C 12: 101,058,332 M303V possibly damaging Het
Prelid2 A T 18: 41,932,716 W85R probably damaging Het
Rabep1 G A 11: 70,919,208 R532H probably damaging Het
Rabgap1l G A 1: 160,700,873 R388W possibly damaging Het
Rad51ap2 G T 12: 11,458,674 V866L probably benign Het
Rassf3 C A 10: 121,476,086 E9* probably null Het
Rbbp4 A C 4: 129,322,387 L189R probably benign Het
Rims2 T A 15: 39,452,390 C597* probably null Het
Rrp12 T A 19: 41,883,490 I452F probably benign Het
Snx29 G A 16: 11,631,527 A279T probably benign Het
Tdh C T 14: 63,500,255 S17N probably benign Het
Tgm5 T C 2: 121,048,890 D555G possibly damaging Het
Thbs1 A C 2: 118,122,564 D885A probably damaging Het
Tmprss9 C A 10: 80,897,867 A921E unknown Het
Trrap T A 5: 144,846,416 F3340I probably damaging Het
Vmn1r72 A T 7: 11,670,218 M101K possibly damaging Het
Vmn2r117 A G 17: 23,460,471 L593P probably benign Het
Washc2 G A 6: 116,221,862 G295E probably damaging Het
Zfp273 A T 13: 67,826,058 H435L probably damaging Het
Zfp395 A G 14: 65,386,499 E139G possibly damaging Het
Zfp512b G A 2: 181,588,218 A552V possibly damaging Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119648890 splice site probably benign
IGL02582:Nusap1 APN 2 119648989 makesense probably null
IGL02732:Nusap1 APN 2 119635580 missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119630386 missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119627667 missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119643830 missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119627691 missense possibly damaging 0.94
R4296:Nusap1 UTSW 2 119639648 missense probably damaging 1.00
R5111:Nusap1 UTSW 2 119630356 nonsense probably null
R5417:Nusap1 UTSW 2 119647143 missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119647099 missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119635513 missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119630421 missense probably benign 0.01
R7947:Nusap1 UTSW 2 119647135 missense possibly damaging 0.95
R9312:Nusap1 UTSW 2 119627638 small deletion probably benign
R9556:Nusap1 UTSW 2 119648963 missense possibly damaging 0.95
RF003:Nusap1 UTSW 2 119627603 small insertion probably benign
RF007:Nusap1 UTSW 2 119627581 small insertion probably benign
RF010:Nusap1 UTSW 2 119627584 small insertion probably benign
RF016:Nusap1 UTSW 2 119627601 small insertion probably benign
RF018:Nusap1 UTSW 2 119627578 small insertion probably benign
RF026:Nusap1 UTSW 2 119627590 small insertion probably benign
RF026:Nusap1 UTSW 2 119627604 small insertion probably benign
RF028:Nusap1 UTSW 2 119627578 small insertion probably benign
RF028:Nusap1 UTSW 2 119627591 small insertion probably benign
RF029:Nusap1 UTSW 2 119627594 small insertion probably benign
RF029:Nusap1 UTSW 2 119627605 small insertion probably benign
RF032:Nusap1 UTSW 2 119627587 small insertion probably benign
RF033:Nusap1 UTSW 2 119627600 small insertion probably benign
RF035:Nusap1 UTSW 2 119627579 small insertion probably benign
RF036:Nusap1 UTSW 2 119627587 small insertion probably benign
RF036:Nusap1 UTSW 2 119627594 small insertion probably benign
RF037:Nusap1 UTSW 2 119627589 small insertion probably benign
RF040:Nusap1 UTSW 2 119627587 small insertion probably benign
RF041:Nusap1 UTSW 2 119627579 small insertion probably benign
RF041:Nusap1 UTSW 2 119627593 small insertion probably benign
RF041:Nusap1 UTSW 2 119627607 nonsense probably null
RF042:Nusap1 UTSW 2 119627607 nonsense probably null
RF043:Nusap1 UTSW 2 119627592 small insertion probably benign
RF045:Nusap1 UTSW 2 119627610 small insertion probably benign
RF046:Nusap1 UTSW 2 119627595 nonsense probably null
RF048:Nusap1 UTSW 2 119627599 small insertion probably benign
RF049:Nusap1 UTSW 2 119627583 small insertion probably benign
RF052:Nusap1 UTSW 2 119627584 small insertion probably benign
RF056:Nusap1 UTSW 2 119627581 small insertion probably benign
RF056:Nusap1 UTSW 2 119627586 small insertion probably benign
RF056:Nusap1 UTSW 2 119627591 small insertion probably benign
RF062:Nusap1 UTSW 2 119627601 small insertion probably benign
RF062:Nusap1 UTSW 2 119627610 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGATGTTAGGCCAGCAGTAC -3'
(R):5'- CGGAACTATCAGGACCTTGAC -3'

Sequencing Primer
(F):5'- GGCCAGCAGTACATTGTTTACAG -3'
(R):5'- CCTCTGTTAAGAATCATGAGGACAAG -3'
Posted On 2021-10-11