Incidental Mutation 'R9010:Ntn4'
ID 685579
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9010 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93640681-93747207 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93644644 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 77 (C77R)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000147080]
AlphaFold Q9JI33
Predicted Effect
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: C77R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147080
AA Change: C40R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123306
Gene: ENSMUSG00000020019
AA Change: C40R

DomainStartEndE-ValueType
LamNT 1 143 4.24e-12 SMART
Meta Mutation Damage Score 0.9419 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,971,645 M87K possibly damaging Het
4931406P16Rik A T 7: 34,239,066 C1015S probably benign Het
Akap2 A T 4: 57,883,192 D845V probably damaging Het
Angel1 T C 12: 86,723,379 S36G possibly damaging Het
Apol6 A G 15: 77,051,497 H322R unknown Het
Arfgef2 G A 2: 166,859,364 R694Q probably damaging Het
Bank1 A T 3: 136,055,798 N748K probably benign Het
Bptf A T 11: 107,073,750 D1539E probably damaging Het
Bst1 T C 5: 43,825,353 I180T possibly damaging Het
Cabin1 C A 10: 75,735,058 E795* probably null Het
Cckar T A 5: 53,699,821 T416S probably damaging Het
Ccng2 G T 5: 93,268,757 E46* probably null Het
Ceacam9 T C 7: 16,721,991 S8P probably benign Het
Cercam G A 2: 29,876,059 D317N possibly damaging Het
Cfap54 T A 10: 92,899,059 M2377L unknown Het
Cgnl1 A T 9: 71,651,349 L914H probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec2g T A 6: 128,948,725 F32L unknown Het
Cntnap5c A T 17: 58,364,164 M1116L probably benign Het
Col11a2 C A 17: 34,064,786 F1516L unknown Het
Crb2 A G 2: 37,790,686 E542G probably benign Het
Crisp1 A T 17: 40,305,210 probably benign Het
Crybg3 G A 16: 59,554,339 T470M probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Entpd3 T C 9: 120,555,759 I134T probably benign Het
Gm19410 A G 8: 35,814,857 M1865V probably benign Het
Gm8251 A G 1: 44,061,473 V155A possibly damaging Het
Gpat2 A G 2: 127,435,226 E728G probably benign Het
Heatr5b C A 17: 78,773,710 S1371I probably damaging Het
Ighv1-4 A T 12: 114,487,329 M53K possibly damaging Het
Itch A T 2: 155,179,071 T169S probably benign Het
Kifc2 A G 15: 76,666,685 N587S possibly damaging Het
Klk1b16 A T 7: 44,140,753 D149V probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lefty2 T A 1: 180,894,607 I170N probably damaging Het
Lrrc14b A G 13: 74,361,032 F419L possibly damaging Het
Mkrn2 T A 6: 115,614,622 V302E possibly damaging Het
Msh4 T C 3: 153,890,182 K271R probably benign Het
Muc6 T C 7: 141,640,084 T1559A unknown Het
Naa16 T G 14: 79,370,042 R289S probably benign Het
Nab1 T A 1: 52,490,451 I96F possibly damaging Het
Nusap1 A G 2: 119,648,975 T424A possibly damaging Het
Olfr1361 A G 13: 21,658,511 Y271H probably damaging Het
Olfr1509 T A 14: 52,451,099 S229T possibly damaging Het
Olfr59 G T 11: 74,289,479 V278F probably damaging Het
Otog A G 7: 46,300,470 D267G probably benign Het
P2ry2 A C 7: 100,998,151 F316V probably benign Het
Padi2 A G 4: 140,936,613 T426A probably damaging Het
Plxna2 T C 1: 194,788,909 F996S possibly damaging Het
Ppp4r3a T C 12: 101,058,332 M303V possibly damaging Het
Prelid2 A T 18: 41,932,716 W85R probably damaging Het
Rabep1 G A 11: 70,919,208 R532H probably damaging Het
Rabgap1l G A 1: 160,700,873 R388W possibly damaging Het
Rad51ap2 G T 12: 11,458,674 V866L probably benign Het
Rassf3 C A 10: 121,476,086 E9* probably null Het
Rbbp4 A C 4: 129,322,387 L189R probably benign Het
Rims2 T A 15: 39,452,390 C597* probably null Het
Rrp12 T A 19: 41,883,490 I452F probably benign Het
Snx29 G A 16: 11,631,527 A279T probably benign Het
Tdh C T 14: 63,500,255 S17N probably benign Het
Tgm5 T C 2: 121,048,890 D555G possibly damaging Het
Thbs1 A C 2: 118,122,564 D885A probably damaging Het
Tmprss9 C A 10: 80,897,867 A921E unknown Het
Trrap T A 5: 144,846,416 F3340I probably damaging Het
Vmn1r72 A T 7: 11,670,218 M101K possibly damaging Het
Vmn2r117 A G 17: 23,460,471 L593P probably benign Het
Washc2 G A 6: 116,221,862 G295E probably damaging Het
Zfp273 A T 13: 67,826,058 H435L probably damaging Het
Zfp395 A G 14: 65,386,499 E139G possibly damaging Het
Zfp512b G A 2: 181,588,218 A552V possibly damaging Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
R9115:Ntn4 UTSW 10 93733813 missense probably benign
R9415:Ntn4 UTSW 10 93644626 missense probably benign 0.00
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAATGGAGTAGCCGGAG -3'
(R):5'- TCCAGGTCTTCCCAAAGTCC -3'

Sequencing Primer
(F):5'- AGTAGCCGGAGCGAACTC -3'
(R):5'- CTGGGAGACTTGAACACCATAATTAG -3'
Posted On 2021-10-11