Incidental Mutation 'R9010:Rad51ap2'
ID 685584
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 068840-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9010 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 11508675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 866 (V866L)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably benign
Transcript: ENSMUST00000124065
AA Change: V866L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: V866L

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 88,119,504 (GRCm39) M87K possibly damaging Het
Angel1 T C 12: 86,770,153 (GRCm39) S36G possibly damaging Het
Apol6 A G 15: 76,935,697 (GRCm39) H322R unknown Het
Arfgef2 G A 2: 166,701,284 (GRCm39) R694Q probably damaging Het
Bank1 A T 3: 135,761,559 (GRCm39) N748K probably benign Het
Bptf A T 11: 106,964,576 (GRCm39) D1539E probably damaging Het
Bst1 T C 5: 43,982,695 (GRCm39) I180T possibly damaging Het
Cabin1 C A 10: 75,570,892 (GRCm39) E795* probably null Het
Ccdc168 A G 1: 44,100,633 (GRCm39) V155A possibly damaging Het
Cckar T A 5: 53,857,163 (GRCm39) T416S probably damaging Het
Ccng2 G T 5: 93,416,616 (GRCm39) E46* probably null Het
Ceacam9 T C 7: 16,455,916 (GRCm39) S8P probably benign Het
Cercam G A 2: 29,766,071 (GRCm39) D317N possibly damaging Het
Cfap54 T A 10: 92,734,921 (GRCm39) M2377L unknown Het
Cgnl1 A T 9: 71,558,631 (GRCm39) L914H probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clec2g T A 6: 128,925,688 (GRCm39) F32L unknown Het
Cntnap5c A T 17: 58,671,159 (GRCm39) M1116L probably benign Het
Col11a2 C A 17: 34,283,760 (GRCm39) F1516L unknown Het
Crb2 A G 2: 37,680,698 (GRCm39) E542G probably benign Het
Crisp1 A T 17: 40,616,101 (GRCm39) probably benign Het
Crybg3 G A 16: 59,374,702 (GRCm39) T470M probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Eif1ad T A 19: 5,418,726 (GRCm39) V93D possibly damaging Het
Entpd3 T C 9: 120,384,825 (GRCm39) I134T probably benign Het
Garre1 A T 7: 33,938,491 (GRCm39) C1015S probably benign Het
Gm19410 A G 8: 36,282,011 (GRCm39) M1865V probably benign Het
Gpat2 A G 2: 127,277,146 (GRCm39) E728G probably benign Het
Heatr5b C A 17: 79,081,139 (GRCm39) S1371I probably damaging Het
Ighv1-4 A T 12: 114,450,949 (GRCm39) M53K possibly damaging Het
Itch A T 2: 155,020,991 (GRCm39) T169S probably benign Het
Kifc2 A G 15: 76,550,885 (GRCm39) N587S possibly damaging Het
Klk1b16 A T 7: 43,790,177 (GRCm39) D149V probably benign Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lefty2 T A 1: 180,722,172 (GRCm39) I170N probably damaging Het
Lrrc14b A G 13: 74,509,151 (GRCm39) F419L possibly damaging Het
Mkrn2 T A 6: 115,591,583 (GRCm39) V302E possibly damaging Het
Msh4 T C 3: 153,595,819 (GRCm39) K271R probably benign Het
Muc6 T C 7: 141,226,351 (GRCm39) T1559A unknown Het
Naa16 T G 14: 79,607,482 (GRCm39) R289S probably benign Het
Nab1 T A 1: 52,529,610 (GRCm39) I96F possibly damaging Het
Ntn4 T C 10: 93,480,506 (GRCm39) C77R Het
Nusap1 A G 2: 119,479,456 (GRCm39) T424A possibly damaging Het
Or1p1 G T 11: 74,180,305 (GRCm39) V278F probably damaging Het
Or2w6 A G 13: 21,842,681 (GRCm39) Y271H probably damaging Het
Or4e2 T A 14: 52,688,556 (GRCm39) S229T possibly damaging Het
Otog A G 7: 45,949,894 (GRCm39) D267G probably benign Het
P2ry2 A C 7: 100,647,358 (GRCm39) F316V probably benign Het
Padi2 A G 4: 140,663,924 (GRCm39) T426A probably damaging Het
Pakap A T 4: 57,883,192 (GRCm39) D845V probably damaging Het
Plxna2 T C 1: 194,471,217 (GRCm39) F996S possibly damaging Het
Ppp4r3a T C 12: 101,024,591 (GRCm39) M303V possibly damaging Het
Prelid2 A T 18: 42,065,781 (GRCm39) W85R probably damaging Het
Rabep1 G A 11: 70,810,034 (GRCm39) R532H probably damaging Het
Rabgap1l G A 1: 160,528,443 (GRCm39) R388W possibly damaging Het
Rassf3 C A 10: 121,311,991 (GRCm39) E9* probably null Het
Rbbp4 A C 4: 129,216,180 (GRCm39) L189R probably benign Het
Rims2 T A 15: 39,315,786 (GRCm39) C597* probably null Het
Rrp12 T A 19: 41,871,929 (GRCm39) I452F probably benign Het
Snx29 G A 16: 11,449,391 (GRCm39) A279T probably benign Het
Tdh C T 14: 63,737,704 (GRCm39) S17N probably benign Het
Tgm5 T C 2: 120,879,371 (GRCm39) D555G possibly damaging Het
Thbs1 A C 2: 117,953,045 (GRCm39) D885A probably damaging Het
Tmprss9 C A 10: 80,733,701 (GRCm39) A921E unknown Het
Trrap T A 5: 144,783,226 (GRCm39) F3340I probably damaging Het
Vmn1r72 A T 7: 11,404,145 (GRCm39) M101K possibly damaging Het
Vmn2r117 A G 17: 23,679,445 (GRCm39) L593P probably benign Het
Washc2 G A 6: 116,198,823 (GRCm39) G295E probably damaging Het
Zfp273 A T 13: 67,974,177 (GRCm39) H435L probably damaging Het
Zfp395 A G 14: 65,623,948 (GRCm39) E139G possibly damaging Het
Zfp512b G A 2: 181,230,011 (GRCm39) A552V possibly damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGAAGAACTTCGAATGTTTCATG -3'
(R):5'- AGTAATTTGTTTCCTTCAGCTTCAG -3'

Sequencing Primer
(F):5'- CAAGTACCAGGATGACAAAC -3'
(R):5'- GGATCTCTATGAGTTTGAATCCAGCC -3'
Posted On 2021-10-11