Incidental Mutation 'R9010:Snx29'
ID 685598
Institutional Source Beutler Lab
Gene Symbol Snx29
Ensembl Gene ENSMUSG00000071669
Gene Name sorting nexin 29
Synonyms 4933437K13Rik, LOC381035, LOC385605, Gm11170, Rundc2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9010 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 11322908-11755472 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11631527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 279 (A279T)
Ref Sequence ENSEMBL: ENSMUSP00000093993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096273] [ENSMUST00000122168] [ENSMUST00000150993] [ENSMUST00000180792]
AlphaFold Q9D3S3
Predicted Effect probably benign
Transcript: ENSMUST00000096273
AA Change: A279T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669
AA Change: A279T

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122168
AA Change: A264T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669
AA Change: A264T

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150993
AA Change: A177T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117896
Gene: ENSMUSG00000071669
AA Change: A177T

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
coiled coil region 23 104 N/A INTRINSIC
Blast:PX 217 245 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180792
AA Change: A621T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669
AA Change: A621T

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,971,645 M87K possibly damaging Het
4931406P16Rik A T 7: 34,239,066 C1015S probably benign Het
Akap2 A T 4: 57,883,192 D845V probably damaging Het
Angel1 T C 12: 86,723,379 S36G possibly damaging Het
Apol6 A G 15: 77,051,497 H322R unknown Het
Arfgef2 G A 2: 166,859,364 R694Q probably damaging Het
Bank1 A T 3: 136,055,798 N748K probably benign Het
Bptf A T 11: 107,073,750 D1539E probably damaging Het
Bst1 T C 5: 43,825,353 I180T possibly damaging Het
Cabin1 C A 10: 75,735,058 E795* probably null Het
Cckar T A 5: 53,699,821 T416S probably damaging Het
Ccng2 G T 5: 93,268,757 E46* probably null Het
Ceacam9 T C 7: 16,721,991 S8P probably benign Het
Cercam G A 2: 29,876,059 D317N possibly damaging Het
Cfap54 T A 10: 92,899,059 M2377L unknown Het
Cgnl1 A T 9: 71,651,349 L914H probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec2g T A 6: 128,948,725 F32L unknown Het
Cntnap5c A T 17: 58,364,164 M1116L probably benign Het
Col11a2 C A 17: 34,064,786 F1516L unknown Het
Crb2 A G 2: 37,790,686 E542G probably benign Het
Crisp1 A T 17: 40,305,210 probably benign Het
Crybg3 G A 16: 59,554,339 T470M probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Entpd3 T C 9: 120,555,759 I134T probably benign Het
Gm19410 A G 8: 35,814,857 M1865V probably benign Het
Gm8251 A G 1: 44,061,473 V155A possibly damaging Het
Gpat2 A G 2: 127,435,226 E728G probably benign Het
Heatr5b C A 17: 78,773,710 S1371I probably damaging Het
Ighv1-4 A T 12: 114,487,329 M53K possibly damaging Het
Itch A T 2: 155,179,071 T169S probably benign Het
Kifc2 A G 15: 76,666,685 N587S possibly damaging Het
Klk1b16 A T 7: 44,140,753 D149V probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lefty2 T A 1: 180,894,607 I170N probably damaging Het
Lrrc14b A G 13: 74,361,032 F419L possibly damaging Het
Mkrn2 T A 6: 115,614,622 V302E possibly damaging Het
Msh4 T C 3: 153,890,182 K271R probably benign Het
Muc6 T C 7: 141,640,084 T1559A unknown Het
Naa16 T G 14: 79,370,042 R289S probably benign Het
Nab1 T A 1: 52,490,451 I96F possibly damaging Het
Ntn4 T C 10: 93,644,644 C77R Het
Nusap1 A G 2: 119,648,975 T424A possibly damaging Het
Olfr1361 A G 13: 21,658,511 Y271H probably damaging Het
Olfr1509 T A 14: 52,451,099 S229T possibly damaging Het
Olfr59 G T 11: 74,289,479 V278F probably damaging Het
Otog A G 7: 46,300,470 D267G probably benign Het
P2ry2 A C 7: 100,998,151 F316V probably benign Het
Padi2 A G 4: 140,936,613 T426A probably damaging Het
Plxna2 T C 1: 194,788,909 F996S possibly damaging Het
Ppp4r3a T C 12: 101,058,332 M303V possibly damaging Het
Prelid2 A T 18: 41,932,716 W85R probably damaging Het
Rabep1 G A 11: 70,919,208 R532H probably damaging Het
Rabgap1l G A 1: 160,700,873 R388W possibly damaging Het
Rad51ap2 G T 12: 11,458,674 V866L probably benign Het
Rassf3 C A 10: 121,476,086 E9* probably null Het
Rbbp4 A C 4: 129,322,387 L189R probably benign Het
Rims2 T A 15: 39,452,390 C597* probably null Het
Rrp12 T A 19: 41,883,490 I452F probably benign Het
Tdh C T 14: 63,500,255 S17N probably benign Het
Tgm5 T C 2: 121,048,890 D555G possibly damaging Het
Thbs1 A C 2: 118,122,564 D885A probably damaging Het
Tmprss9 C A 10: 80,897,867 A921E unknown Het
Trrap T A 5: 144,846,416 F3340I probably damaging Het
Vmn1r72 A T 7: 11,670,218 M101K possibly damaging Het
Vmn2r117 A G 17: 23,460,471 L593P probably benign Het
Washc2 G A 6: 116,221,862 G295E probably damaging Het
Zfp273 A T 13: 67,826,058 H435L probably damaging Het
Zfp395 A G 14: 65,386,499 E139G possibly damaging Het
Zfp512b G A 2: 181,588,218 A552V possibly damaging Het
Other mutations in Snx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Snx29 APN 16 11403502 missense probably damaging 0.97
IGL02207:Snx29 APN 16 11738352 missense probably damaging 1.00
PIT1430001:Snx29 UTSW 16 11403624 missense probably benign 0.00
PIT4810001:Snx29 UTSW 16 11400981 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0276:Snx29 UTSW 16 11738373 missense probably benign 0.01
R0506:Snx29 UTSW 16 11395303 missense probably benign 0.15
R0621:Snx29 UTSW 16 11405787 splice site probably null
R0975:Snx29 UTSW 16 11347871 missense possibly damaging 0.66
R1225:Snx29 UTSW 16 11420686 intron probably benign
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1452:Snx29 UTSW 16 11631471 missense probably damaging 1.00
R1515:Snx29 UTSW 16 11399837 critical splice donor site probably null
R1874:Snx29 UTSW 16 11367681 missense probably benign 0.01
R1953:Snx29 UTSW 16 11399783 nonsense probably null
R1978:Snx29 UTSW 16 11367724 missense probably benign 0.23
R2054:Snx29 UTSW 16 11631492 missense probably damaging 1.00
R2105:Snx29 UTSW 16 11511034 missense possibly damaging 0.72
R2128:Snx29 UTSW 16 11400971 missense probably damaging 0.98
R2152:Snx29 UTSW 16 11400843 missense possibly damaging 0.95
R2912:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2913:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2914:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R4468:Snx29 UTSW 16 11420701 splice site probably null
R4469:Snx29 UTSW 16 11420701 splice site probably null
R4612:Snx29 UTSW 16 11447495 missense probably damaging 0.99
R4744:Snx29 UTSW 16 11349909 nonsense probably null
R4798:Snx29 UTSW 16 11420736 missense probably damaging 1.00
R5000:Snx29 UTSW 16 11403507 missense probably damaging 0.99
R5165:Snx29 UTSW 16 11420775 missense probably damaging 0.98
R5207:Snx29 UTSW 16 11738363 missense probably damaging 1.00
R5235:Snx29 UTSW 16 11413246 missense possibly damaging 0.94
R5274:Snx29 UTSW 16 11738404 missense probably damaging 1.00
R5277:Snx29 UTSW 16 11399824 missense possibly damaging 0.82
R5462:Snx29 UTSW 16 11511012 missense possibly damaging 0.89
R5655:Snx29 UTSW 16 11755321 missense probably damaging 1.00
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6326:Snx29 UTSW 16 11403566 missense probably benign
R6576:Snx29 UTSW 16 11715056 critical splice donor site probably null
R7406:Snx29 UTSW 16 11755316 missense probably damaging 1.00
R7552:Snx29 UTSW 16 11420785 critical splice donor site probably null
R7555:Snx29 UTSW 16 11400942 missense probably benign 0.02
R7736:Snx29 UTSW 16 11367724 missense probably benign 0.23
R7962:Snx29 UTSW 16 11413357 critical splice donor site probably null
R8101:Snx29 UTSW 16 11571716 missense probably benign 0.16
R8415:Snx29 UTSW 16 11447427 missense probably damaging 1.00
R8549:Snx29 UTSW 16 11715056 critical splice donor site probably null
R9091:Snx29 UTSW 16 11395291 missense probably benign 0.33
R9099:Snx29 UTSW 16 11660571 missense probably damaging 1.00
R9176:Snx29 UTSW 16 11418864 missense probably benign
R9258:Snx29 UTSW 16 11714935 missense possibly damaging 0.78
R9270:Snx29 UTSW 16 11395291 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTCAAGGTTGCATGCCAC -3'
(R):5'- AACAAGGGTGTGTGCTTGTCTAC -3'

Sequencing Primer
(F):5'- AAGGTTGCATGCCACTGCTG -3'
(R):5'- GTGTGTGCTTGTCTACTTCCTGTAC -3'
Posted On 2021-10-11