Incidental Mutation 'R9011:Vwa3b'
ID 685609
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Name von Willebrand factor A domain containing 3B
Synonyms 4921511C04Rik, A230074B11Rik
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9011 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 37026596-37187613 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37115686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 517 (N517S)
Ref Sequence ENSEMBL: ENSMUSP00000027289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289]
AlphaFold A0A571BE33
Predicted Effect probably damaging
Transcript: ENSMUST00000027289
AA Change: N517S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122
AA Change: N517S

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,304 I176F possibly damaging Het
Actr10 A G 12: 70,952,960 T177A probably benign Het
Adgrb2 G A 4: 130,022,318 D1468N probably damaging Het
AF067061 A G 13: 120,264,210 T137A probably damaging Het
Aldh16a1 A G 7: 45,145,527 F506S probably damaging Het
Ankfn1 A T 11: 89,526,618 M56K probably benign Het
Atxn7l2 T C 3: 108,207,440 S97G probably benign Het
Cacna1g C T 11: 94,415,837 G1905D probably benign Het
Ccne1 A T 7: 38,106,660 M13K probably benign Het
Chil3 A T 3: 106,149,715 Y304* probably null Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Cldn23 T A 8: 35,825,672 I221F probably damaging Het
Col16a1 T C 4: 130,052,859 F92L unknown Het
Cyp2w1 T A 5: 139,354,559 V199E possibly damaging Het
Dmxl1 A G 18: 49,864,173 Y512C probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif3l T G 15: 79,089,525 M380R possibly damaging Het
Fam71a A C 1: 191,163,061 S462A probably benign Het
Fer1l5 A T 1: 36,402,520 K605N probably damaging Het
Fgfbp1 T G 5: 43,979,285 N222H probably benign Het
Flcn A G 11: 59,799,407 L273P possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gfi1 A G 5: 107,725,559 probably null Het
Ift57 A G 16: 49,759,414 Q316R probably benign Het
Itga11 T C 9: 62,755,627 F542L probably benign Het
Kif28 G C 1: 179,702,419 L726V possibly damaging Het
Krt90 A G 15: 101,562,800 I9T probably benign Het
Lefty1 A T 1: 180,937,676 M270L probably benign Het
Mipol1 A T 12: 57,457,079 E344D probably benign Het
Mon2 A T 10: 123,026,308 M737K possibly damaging Het
Mrpl14 A G 17: 45,698,404 N143S probably benign Het
Nelfcd T A 2: 174,426,924 H589Q probably benign Het
Npepps T C 11: 97,240,931 M366V probably damaging Het
Olfr1448 A T 19: 12,920,115 S65T probably damaging Het
Platr25 T A 13: 62,700,466 H194L probably damaging Het
Plekhg4 T C 8: 105,375,652 I127T probably benign Het
Rarb A G 14: 16,435,140 V302A probably damaging Het
Rc3h1 A C 1: 160,965,103 T1037P probably damaging Het
Rnaset2a G A 17: 8,137,928 P102S probably damaging Het
Scn10a A C 9: 119,630,094 S1166R probably damaging Het
Scn3a A G 2: 65,521,826 M380T possibly damaging Het
Serpinb13 A G 1: 106,995,789 I75V probably benign Het
Slc35f5 G A 1: 125,562,313 A27T probably benign Het
Slc45a3 G A 1: 131,977,976 V246I probably benign Het
Slc7a14 G A 3: 31,224,196 T420I probably damaging Het
Slc9a9 A G 9: 94,936,440 T296A probably benign Het
Smyd2 G A 1: 189,896,636 H157Y probably damaging Het
Spata32 T A 11: 103,209,851 H30L probably benign Het
Srarp T C 4: 141,433,033 E163G possibly damaging Het
Tmed8 A G 12: 87,174,164 I216T probably damaging Het
Tnni3k A T 3: 154,856,549 L697Q probably damaging Het
Tra2b G A 16: 22,247,190 R286C unknown Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Ttn T C 2: 76,710,162 D34160G possibly damaging Het
Umad1 T A 6: 8,373,931 C36* probably null Het
Ush2a A T 1: 188,906,479 T4029S probably damaging Het
Usp9y C T Y: 1,316,978 S1857N probably benign Het
Zfp583 G A 7: 6,316,628 P462S probably damaging Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
R9263:Vwa3b UTSW 1 37060412 missense probably benign 0.43
R9277:Vwa3b UTSW 1 37157453 critical splice donor site probably null
R9294:Vwa3b UTSW 1 37035801 missense probably damaging 0.99
R9341:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
R9343:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGAGGCCAAACATCCAG -3'
(R):5'- TTCATGTATAGACACCGCCTG -3'

Sequencing Primer
(F):5'- GCCAAACATCCAGACTATATCATTTG -3'
(R):5'- GGTGCCCAAGCCATTTCTCAG -3'
Posted On 2021-10-11